FSHR

Gene Information
 
Gene Symbol
FSHR
 
Aliases
FSHR1, FSHRO, LGR1, ODG1
 
Entrez Gene ID
 
Gene Name
Follicle stimulating hormone receptor
 
Chromosomal Location
2p16.3
 
HGNC ID
 
Summary
The protein encoded by this gene belongs to family 1 of G-protein coupled receptors. It is the receptor for follicle stimulating hormone and functions in gonad development. Mutations in this gene cause ovarian dysgenesis type 1, and also ovarian hyperstimulation syndrome. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2010]
 
RefSeq DNA
 
RefSeq mRNA
  e!Ensembl
Gene
Transcript  
Protein

SNPs

SNP Id
Upstream Sequence
SNP
Downstream Sequence Functional Significance References
rs6165 GGCAAGAAGTTGATTATATGACTCAG
A/G
CTAGGGGTCAGAGATCCTCTCTGGC A307T 19403562
rs6166 CTGCTCTTCAGCTCCCAGAGTCACCA
A/G
TGGTTCCACTTACATACTTGTCCCT N680S 19403562
rs11692782 GGACTGCAGGGCGCTCACGCTTGCTG
C/T
GAAGTAAGGCGTTTGAAGGTGAGGC Intron variant 25649397
rs2268361 TTGTGGGACTTCAGAAGAGAGAAAGA
C/T
GTGGGCTGGACATCAAAGAAGGCCT Intron variant 25904635

Gene Ontology (GO)

GO ID Ontology Function Evidence Reference
GO:0007186 Biological process G protein-coupled receptor signaling pathway IDA 24692546
GO:0007189 Biological process Adenylate cyclase-activating G protein-coupled receptor signaling pathway IBA 21873635
GO:0007190 Biological process Activation of adenylate cyclase activity IBA 21873635
GO:0007283 Biological process Spermatogenesis TAS 9020851
GO:0007292 Biological process Female gamete generation TAS 9020851
Protein Information
 
Protein Name
Follicle-stimulating hormone receptor, FSH receptor, follitropin receptor
 
Function
G protein-coupled receptor for follitropin, the follicle-stimulating hormone (PubMed:11847099, PubMed:24058690, PubMed:24692546). Through cAMP production activates the downstream PI3K-AKT and ERK1/ERK2 signaling pathways
 
Refseq Proteins
 
UniProt
Pathways
 
KEGG
 
Reactome
 

cAMP signaling pathway
Neuroactive ligand-receptor interaction
Ovarian steroidogenesis

 

Hormone ligand-binding receptors
G alpha (s) signalling events
ADORA2B mediated anti-inflammatory cytokines production

Interactions
 
STRING MINT IntAct
ENSP00000480004 P07099
    View interactions
     

Associated Diseases

Disease groupDisease NameReferences
Endocrine System Diseases
Gonadal Dysgenesis, 46,XX
Ovarian Hyperstimulation Syndrome
PCOS
Neoplasms
Prostate Carcinoma
Ovarian Cancer
References
 
 
PubMed ID Associated gene/s Associated condition Genetic Mutation Diagnostic Criteria Association with PCOS Ethnicity Conclusion
 
 
rs7562215, rs10495960, rs13405728, rs35960650, rs2956355, and rs7562879 
NIH criteria 
Direct 
905 women with PCOS, 956 control women  
Fine mapping of the chromosome 2p16.3 Chinese PCOS susceptibility locus in a European ancestry cohort provides evidence for association with two independent loci and PCOS. The gene products LHCGR and FSHR therefore are likely to be important in the etiology of PCOS, regardless of ethnicity 
LHCGR, THADA, DENND1A, c9orf3, YAP1, RAB5B/SUOX, HMGA2, TOX3, INSR, SUMO1P1 
 
rs2268361,rs2349415  
Rotterdam criteria 
Direct 
703 Dutch PCOS patients and 2164 Dutch controls 
This study identifies 12 genetic variants mapping to the Chinese PCOS loci similar effect size and identical direction in PCOS patients from Northern European ancestry, indicating a common genetic risk profile for PCOS across populations 
 
 
 
 
Direct 
47 European subjects with PCOS and 845 controls 
Four of the PCOS susceptibility loci identified in the Chinese GWAS are associated with PCOS in Europeans 
LHCGR, THADA, KHDRBS3, YAP1, RAB5BandTOX3 
hyperandrogenemia, menstruation number/year and polycystic ovary morphology 
rs2268361 
 
Direct 
862 women with PCOS and 860 controls in the Korean population 
The GRS was higher in women with PCOS than in controls (8.8 versus 8.2, P < 0.01) and was significantly associated with PCOS after adjusting for age and BMI 

| © 2019, Biomedical Informatics Centre, NIRRH |
National Institute for Research in Reproductive Health, Jehangir Merwanji Street, Parel, Mumbai-400 012
Tel: 91-22-24192104, Fax No: 91-22-24139412