MEP1A

Gene Information
 
Gene Symbol
MEP1A
 
Aliases
PPHA
 
Entrez Gene ID
 
Gene Name
Meprin A subunit alpha
 
Chromosomal Location
6p12.3
 
HGNC ID
  e!Ensembl
Gene
Transcript  
Protein

SNPs

SNP Id
Upstream Sequence
SNP
Downstream Sequence Functional Significance References
rs17468190 CGATTACTACGCCTACAGCCCTGTGC
A/G
GGAGCGGGACGCCCACTCCGTCCTC Intron variant,utr variant 3 prime 24388959

Gene Ontology (GO)

GO ID Ontology Function Evidence Reference
GO:0005615 Cellular component Extracellular space TAS 8262185
GO:0005887 Cellular component Integral component of plasma membrane TAS 8262185
GO:0017090 Cellular component Meprin A complex IBA 21873635
GO:0017090 Cellular component Meprin A complex IDA 9288916
GO:0070062 Cellular component Extracellular exosome HDA 11487543
Protein Information
 
Protein Name
Meprin A subunit alpha, N-benzoyl-L-tyrosyl-P-amino-benzoic acid hydrolase subunit alpha, PABA peptide hydrolase, PPH alpha, bA268F1.1 (meprin A alpha (PABA peptide hydrolase)), endopeptidase-2, meprin A, alpha (PABA peptide hydrolase)
 
Function
 
UniProt
 
Pfam
Pfam Accession Pfam ID
PF01400 Astacin
PF00008 EGF
PF00629 MAM
Pathways
 
KEGG
 
 

Protein digestion and absorption

 

Interactions
 
STRING MINT IntAct
ENSP00000484824 P15941 P15941
    View interactions
     

Associated Diseases

Disease groupDisease NameReferences
Endocrine System Diseases
PCOS
Neoplasms
Colonic Neoplasms
References
 
 
PubMed ID Associated gene/s Associated condition Genetic Mutation Diagnostic Criteria Association with PCOS Ethnicity Conclusion
 
PCOS, obesity 
rs17468190 
 
Related 
576PCOSwomen, 206 controls 
MEP1A gene was more strongly associated with insulin metabolism in overweight/obese PCOS women. MEP1Ais a possible target gene for disease modification inPCOS. 

| © 2019, Biomedical Informatics Centre, NIRRH |
National Institute for Research in Reproductive Health, Jehangir Merwanji Street, Parel, Mumbai-400 012
Tel: 91-22-24192104, Fax No: 91-22-24139412