THADA

Gene Information
 
Gene Symbol
THADA
 
Aliases
ARMC13, GITA
 
Entrez Gene ID
 
Gene Name
THADA armadillo repeat containing
 
Chromosomal Location
2p21
 
HGNC ID
 
Summary
This gene is the target of 2p21 choromosomal aberrations in benign thyroid adenomas. Single nucleotide polymorphisms (SNPs) in this gene may be associated with type 2 diabetes and polycystic ovary syndrome. The encoded protein is likely involved in the death receptor pathway and apoptosis. [provided by RefSeq, Sep 2016]
 
RefSeq DNA
 
RefSeq mRNA
  e!Ensembl
Gene
Transcript  
Protein

SNPs

SNP Id
Upstream Sequence
SNP
Downstream Sequence Functional Significance References
rs13429458 TGCTGTGCAAAGTTAGAAGATGAAAC
A/C
AAACTGATTACATACACCTATACCC Intron variant 25586784, 21151128
rs12478601 ATTCCTGCTGGTCTTGGTTAGTACCA
C/T
TCAATAAAATGTTAGGACCCGGGCT Intron variant 25586784

Gene Ontology (GO)

GO ID Ontology Function Evidence Reference
GO:0030488 Biological process TRNA methylation IBA 21873635
GO:0032471 Biological process Negative regulation of endoplasmic reticulum calcium ion concentration IMP 28399403
GO:0055088 Biological process Lipid homeostasis IGI 28399403
GO:0005829 Cellular component Cytosol IBA 21873635
GO:0005515 Molecular function Protein binding IPI 25416956
Protein Information
 
Protein Name
Thyroid adenoma-associated protein, death receptor-interacting protein, gene inducing thyroid adenomas protein
 
Function
 
Refseq Proteins
 
UniProt
 
PDB
Pathways
 
Reactome
 

 

tRNA modification in the nucleus and cytosol

Interactions
 
STRING MINT IntAct
ENSP00000323587 Q8WWA0
    View interactions
     

Associated Diseases

Disease groupDisease NameReferences
Cardiovascular Diseases
Coronary heart disease
Arteriosclerosis
Congenital, Hereditary, and Neonatal Diseases and Abnormalities
Cleft upper lip
Digestive System Diseases
Crohn Disease
Colitis
References
 
 
PubMed ID Associated gene/s Associated condition Genetic Mutation Diagnostic Criteria Association with PCOS Ethnicity Conclusion
 
 
SNP rs13429458 
Rotterdam criteria 
Related 
A total of 276 family trios (828 participants) having a proband with PCOS  
TDT confirms that SNP rs13429458, in the THADA gene, is significantly associated with risk of PCOS 
DENND1A 
Hyperandrogenism and irregular menses 
Variation in the DENND1A 
NICHD criteria 
Direct 
European derived PCOS cohorts-(cohort A = 939 cases and 957 controls) and (cohort B = 535 cases and 845 controls) 
At least two of the PCOS susceptibility loci identified in the Chinese PCOS GWAS (DENND1A and THADA) are also associated with PCOS in European derived populations, and are therefore likely to be important in the aetiology of PCOS regardless of ethnicity. The analysis of the LHCGR gene was not sufficiently powered to detect modest effects. 
DENND1A and LHCGR 
 
SNP variants rs13429458, rs12478601, rs2479106, rs10818854 and rs13405728 
Rotterdam criteria 
Direct 
1731 PCOS patients and 4964 controls 
carry risk alleles that are associated with endocrine and metabolic disturbances in PCOS patients 
LHCGR, DENND1A, FSHR, c9orf3, YAP1, RAB5B/SUOX, HMGA2, TOX3, INSR, SUMO1P1 
 
rs12468394, rs13429458, rs12478601  
Rotterdam criteria 
Direct 
703 Dutch PCOS patients and 2164 Dutch controls 
This study identifies 12 genetic variants mapping to the Chinese PCOS loci similar effect size and identical direction in PCOS patients from Northern European ancestry, indicating a common genetic risk profile for PCOS across populations 
 
 
 
 
Direct 
46 European subjects with PCOS and 845 controls 
Four of the PCOS susceptibility loci identified in the Chinese GWAS are associated with PCOS in Europeans 

| © 2019, Biomedical Informatics Centre, NIRRH |
National Institute for Research in Reproductive Health, Jehangir Merwanji Street, Parel, Mumbai-400 012
Tel: 91-22-24192104, Fax No: 91-22-24139412