TOX3

Gene Information
 
Gene Symbol
TOX3
 
Aliases
CAGF9, TNRC9
 
Entrez Gene ID
 
Gene Name
TOX high mobility group box family member 3
 
Chromosomal Location
16q12.1
 
HGNC ID
 
Summary
The protein encoded by this gene contains an HMG-box, indicating that it may be involved in bending and unwinding of DNA and alteration of chromatin structure. The C-terminus of the encoded protein is glutamine-rich due to CAG repeats in the coding sequence. A minor allele of this gene has been implicated in an elevated risk of breast cancer. Two transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Apr 2009]
 
RefSeq DNA
 
RefSeq mRNA
  e!Ensembl
Gene
Transcript  
Protein

SNPs

SNP Id
Upstream Sequence
SNP
Downstream Sequence Functional Significance References
rs4784165 GGACTGCAGGGCGCTCACGCTTGCTG
C/T
GAAGTAAGGCGTTTGAAGGTGAGGC 25311971, 28537684, 22885925

Gene Ontology (GO)

GO ID Ontology Function Evidence Reference
GO:0042981 Biological process Regulation of apoptotic process IDA 21172805
GO:0043524 Biological process Negative regulation of neuron apoptotic process IDA 21172805
GO:0045893 Biological process Positive regulation of transcription, DNA-templated IDA 21172805
GO:0000981 Molecular function DNA-binding transcription factor activity, RNA polymerase II-specific ISM 19274049
GO:0003682 Molecular function Chromatin binding IDA 21172805
Protein Information
 
Protein Name
TOX high mobility group box family member 3, CAG trinucleotide repeat-containing gene F9 protein, trinucleotide repeat-containing gene 9 protein
 
Function
Transcriptional coactivator of the p300/CBP-mediated transcription complex. Activates transactivation through cAMP response element (CRE) sites. Protects against cell death by inducing antiapoptotic and repressing pro-apoptotic transcripts. Stimulates transcription from the estrogen-responsive or BCL-2 promoters. Required for depolarization-induced transcription activation of the C-FOS promoter in neurons. Associates with chromatin to the estrogen-responsive C3 promoter region.
 
Refseq Proteins
 
UniProt
 
Pfam
Pfam Accession Pfam ID
PF00505 HMG_box
Interactions
 
STRING MINT IntAct
ENSP00000223862 P04808
    View interactions
     

Associated Diseases

Disease groupDisease NameReferences
Endocrine System Diseases
PCOS
Neoplasms
Breast Cancer
Liver Cancer
Breast Cancer,Male
References
 
 
PubMed ID Associated gene/s Associated condition Genetic Mutation Diagnostic Criteria Association with PCOS Ethnicity Conclusion
LHCGR, THADA, FSHR, KHDRBS3, YAP1 and RAB5B 
hyperandrogenemia, menstruation number/year and polycystic ovary morphology 
rs11075466 
 
Direct 
862 women with PCOS and 860 controls in the Korean population 
The GRS was higher in women with PCOS than in controls (8.8 versus 8.2, P < 0.01) and was significantly associated with PCOS after adjusting for age and BMI 

| © 2019, Biomedical Informatics Centre, NIRRH |
National Institute for Research in Reproductive Health, Jehangir Merwanji Street, Parel, Mumbai-400 012
Tel: 91-22-24192104, Fax No: 91-22-24139412