YAP1

Gene Information
 
Gene Symbol
YAP1
 
Aliases
COB1, YAP, YAP2, YAP65, YKI
 
Entrez Gene ID
 
Gene Name
Yes1 associated transcriptional regulator
 
Chromosomal Location
11q22.1
 
HGNC ID
 
Summary
This gene encodes a downstream nuclear effector of the Hippo signaling pathway which is involved in development, growth, repair, and homeostasis. This gene is known to play a role in the development and progression of multiple cancers as a transcriptional regulator of this signaling pathway and may function as a potential target for cancer treatment. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Aug 2013]
 
RefSeq DNA
 
RefSeq mRNA
  e!Ensembl
Gene
Transcript  
Protein

SNPs

SNP Id
Upstream Sequence
SNP
Downstream Sequence Functional Significance References
rs1894116 TTGTGGGACTTCAGAAGAGAGAAAGA
C/T
GTGGGCTGGACATCAAAGAAGGCCT Intron variant 22885925

Gene Ontology (GO)

GO ID Ontology Function Evidence Reference
GO:0006974 Biological process Cellular response to DNA damage stimulus IDA 18280240
GO:0008283 Biological process Cell proliferation IDA 17974916
GO:0032570 Biological process Response to progesterone IDA 16772533
GO:0033148 Biological process Positive regulation of intracellular estrogen receptor signaling pathway IDA 16772533
GO:0035329 Biological process Hippo signaling IBA 21873635
Protein Information
 
Protein Name
Transcriptional coactivator YAP1, 65 kDa Yes-associated protein, Yes associated protein 1, protein yorkie homolog, yes-associated protein 1, yes-associated protein 2, yes-associated protein YAP65 homolog, yorkie homolog
 
Function
Transcriptional regulator which can act both as a coactivator and a corepressor and is the critical downstream regulatory target in the Hippo signaling pathway that plays a pivotal role in organ size control and tumor suppression by restricting proliferation and promoting apoptosis (PubMed:17974916, PubMed:18280240, PubMed:18579750, PubMed:21364637, PubMed:30447097). The core of this pathway is composed of a kinase cascade wherein STK3/MST2 and STK4/MST1, in complex with its regulatory protein SAV1, phosphorylates and activates LATS1/2 in complex with its regulatory protein MOB1, which in turn phosphorylates and inactivates YAP1 oncoprotein and WWTR1/TAZ (PubMed:18158288). Plays a key role in tissue tension and 3D tissue shape by regulating cortical actomyosin network formation. Acts via ARHGAP18, a Rho GTPase activating protein that suppresses F-actin polymerization (PubMed:25778702). Plays a key role to control cell proliferation in response to cell contact. Phosphorylation of YAP1 by LATS1/2 inhibits its translocation into the nucleus to regulate cellular genes important for cell proliferation, cell death, and cell migration (PubMed:18158288). The presence of TEAD transcription factors are required for it to stimulate gene expression, cell growth, anchorage-independent growth, and epithelial mesenchymal transition (EMT) induction (PubMed:18579750). .; [Isoform 2]: Isoform 2 and isoform 3 can activate the C-terminal fragment (CTF) of ERBB4 (isoform 3).
 
Refseq Proteins
 
UniProt
 
PDB
Pathways
 
KEGG
 
Reactome
 

Hippo signaling pathway
Hippo signaling pathway - multiple species

 

Nuclear signaling by ERBB4
Signaling by Hippo
YAP1- and WWTR1 (TAZ)-stimulated gene expression
RUNX1 regulates transcription of genes involved in differentiation of HSCs
RUNX3 regulates YAP1-mediated transcription
EGR2 and SOX10-mediated initiation of Schwann cell myelination

Interactions
 
STRING MINT IntAct
ENSP00000287641 P61278
    View interactions
     

Associated Diseases

Disease groupDisease NameReferences
Congenital, Hereditary, and Neonatal Diseases and Abnormalities
Congenital ocular coloboma
Endocrine System Diseases
PCOS
Musculoskeletal Diseases
Coloboma, Uveal, with Cleft Lip and Palate and Mental Retardation
Neoplasms
Brain Neoplasms
Breast Cancer
References
 
 
PubMed ID Associated gene/s Associated condition Genetic Mutation Diagnostic Criteria Association with PCOS Ethnicity Conclusion
LHCGR, THADA, DENND1A, FSHR, c9orf3, RAB5B/SUOX, HMGA2, TOX3, INSR, SUMO1P1 
 
rs1894116 
Rotterdam criteria 
Direct 
703 Dutch PCOS patients and 2164 Dutch controls 
This study identifies 12 genetic variants mapping to the Chinese PCOS loci similar effect size and identical direction in PCOS patients from Northern European ancestry, indicating a common genetic risk profile for PCOS across populations 
 
PCOS 
 
Rotterdam criteria 
Direct 
1115PCOSpatients, 1137 controls 
YAP1 appears to be a new susceptibility gene forPCOSin Han Chinese women 
LHCGR, THADA, FSHR, KHDRBS3, RAB5BandTOX3 
hyperandrogenemia, menstruation number/year and polycystic ovary morphology 
rs1894116 
 
Direct 
862 women with PCOS and 860 controls in the Korean population 
The GRS was higher in women with PCOS than in controls (8.8 versus 8.2, P < 0.01) and was significantly associated with PCOS after adjusting for age and BMI 

| © 2019, Biomedical Informatics Centre, NIRRH |
National Institute for Research in Reproductive Health, Jehangir Merwanji Street, Parel, Mumbai-400 012
Tel: 91-22-24192104, Fax No: 91-22-24139412