ACVR1: Polycystic Ovarian Syndrome Database

Gene Information

Gene Symbol

ACVR1

Aliases

ACTRI, ACVR1A, ACVRLK2, ALK2, FOP, SKR1, TSRI

Entrez Gene ID

Gene Name

Activin A receptor type 1

Chromosomal Location

2q24.1

HGNC ID

HGNC:171

Summary

Activins are dimeric growth and differentiation factors which belong to the transforming growth factor-beta (TGF-beta) superfamily of structurally related signaling proteins. Activins signal through a heteromeric complex of receptor serine kinases which include at least two type I ( I and IB) and two type II (II and IIB) receptors. These receptors are all transmembrane proteins, composed of a ligand-binding extracellular domain with cysteine-rich region, a transmembrane domain, and a cytoplasmic domain with predicted serine/threonine specificity. Type I receptors are essential for signaling; and type II receptors are required for binding ligands and for expression of type I receptors. Type I and II receptors form a stable complex after ligand binding, resulting in phosphorylation of type I receptors by type II receptors. This gene encodes activin A type I receptor which signals a particular transcriptional response in concert with activin type II receptors. Mutations in this gene are associated with fibrodysplasia ossificans progressive. [provided by RefSeq, Jul 2008]

RefSeq DNA

NG_008004.1

RefSeq mRNA

NM_001105.5, NM_001111067.4, NM_001347663.1, NM_001347664.1, NM_001347665.1, NM_001347666.1, NM_001347667.2

e!Ensembl

Gene	ENSG00000115170
Transcript	ENST00000263640, ENST00000434821, ENST00000409283, ENST00000672582, ENST00000673324, ENST00000424669, ENST00000539637, ENST00000410057, ENST00000412025, ENST00000440523, ENST00000413751
Protein	ENSP00000263640, ENSP00000405004, ENSP00000387273, ENSP00000500605, ENSP00000500109, ENSP00000400767, ENSP00000440091, ENSP00000387127, ENSP00000403006, ENSP00000401189, ENSP00000399322

SNPs

SNP Id	Upstream Sequence	SNP	Downstream Sequence	Functional Significance	References
rs1220134	CTTGAGGATCATATTACTCCAAGAGA	A/T	CTATCTGGTCATCAATTTTTATAAT	Intron variant	18854405
rs10497189	CCACAATATGCATCAAAATGTGTTCT	C/T	GGACATTAGTTATTCTTAATAAAGA	Intron variant	18854405
rs2033962	GTGCCATAGACCTTTGGAGGGAGCTC	G/T	GAAAGCTGAATTTCCTAATATGAAC	Intron variant	18854405

Gene Ontology (GO)

Show/Hide all(52 )

GO ID	Ontology	Function	Evidence	Reference
GO:0000082	Biological process	G1/S transition of mitotic cell cycle	IMP	9884026
GO:0003143	Biological process	Embryonic heart tube morphogenesis	IMP	19506109
GO:0003183	Biological process	Mitral valve morphogenesis	IMP	19506109
GO:0003289	Biological process	Atrial septum primum morphogenesis	IMP	19506109
GO:0006468	Biological process	Protein phosphorylation	IDA	12065756, 19506109
GO:0007179	Biological process	Transforming growth factor beta receptor signaling pathway	IBA	21873635
GO:0007179	Biological process	Transforming growth factor beta receptor signaling pathway	IDA	8242742
GO:0007389	Biological process	Pattern specification process	IBA	21873635
GO:0007507	Biological process	Heart development	IBA	21873635
GO:0009968	Biological process	Negative regulation of signal transduction	IMP	9884026
GO:0010862	Biological process	Positive regulation of pathway-restricted SMAD protein phosphorylation	IDA	19506109
GO:0018107	Biological process	Peptidyl-threonine phosphorylation	IDA	19736306
GO:0030278	Biological process	Regulation of ossification	IMP	16642017
GO:0030335	Biological process	Positive regulation of cell migration	IGI	19736306
GO:0030501	Biological process	Positive regulation of bone mineralization	IMP	18436533
GO:0030509	Biological process	BMP signaling pathway	IDA	18436533
GO:0032924	Biological process	Activin receptor signaling pathway	IDA	19506109
GO:0032924	Biological process	Activin receptor signaling pathway	IMP	18326817
GO:0032926	Biological process	Negative regulation of activin receptor signaling pathway	IMP	9884026
GO:0045669	Biological process	Positive regulation of osteoblast differentiation	IMP	18436533
GO:0045893	Biological process	Positive regulation of transcription, DNA-templated	IDA	8242742
GO:0045944	Biological process	Positive regulation of transcription by RNA polymerase II	IDA	19506109
GO:0045944	Biological process	Positive regulation of transcription by RNA polymerase II	IMP	18326817
GO:0060389	Biological process	Pathway-restricted SMAD protein phosphorylation	IDA	19736306
GO:0060923	Biological process	Cardiac muscle cell fate commitment	IMP	19506109
GO:0061445	Biological process	Endocardial cushion cell fate commitment	IMP	19506109
GO:0071773	Biological process	Cellular response to BMP stimulus	IMP	18326817
GO:2000017	Biological process	Positive regulation of determination of dorsal identity	IDA	19506109
GO:2001237	Biological process	Negative regulation of extrinsic apoptotic signaling pathway	IMP	9884026
GO:0005887	Cellular component	Integral component of plasma membrane	IBA	21873635
GO:0005887	Cellular component	Integral component of plasma membrane	IDA	8242742
GO:0043235	Cellular component	Receptor complex	IBA	21873635
GO:0048179	Cellular component	Activin receptor complex	IBA	21873635
GO:0048179	Cellular component	Activin receptor complex	IDA	8242742
GO:0004672	Molecular function	Protein kinase activity	IDA	19736306
GO:0004674	Molecular function	Protein serine/threonine kinase activity	IDA	12065756
GO:0004675	Molecular function	Transmembrane receptor protein serine/threonine kinase activity	NAS	8242742
GO:0005024	Molecular function	Transforming growth factor beta-activated receptor activity	IBA	21873635
GO:0005025	Molecular function	Transforming growth factor beta receptor activity, type I	IBA	21873635
GO:0005515	Molecular function	Protein binding	IPI	8242742, 8555189, 11266516, 18436533
GO:0005524	Molecular function	ATP binding	IDA	12065756
GO:0016361	Molecular function	Activin receptor activity, type I	IBA	21873635
GO:0016361	Molecular function	Activin receptor activity, type I	IDA	8242742
GO:0017046	Molecular function	Peptide hormone binding	NAS	12702211
GO:0019838	Molecular function	Growth factor binding	IBA	21873635
GO:0042803	Molecular function	Protein homodimerization activity	IDA	18436533
GO:0046332	Molecular function	SMAD binding	IBA	21873635
GO:0046332	Molecular function	SMAD binding	IDA	12065756
GO:0048185	Molecular function	Activin binding	IBA	21873635
GO:0048185	Molecular function	Activin binding	IDA	8242742
GO:0050431	Molecular function	Transforming growth factor beta binding	IDA	8242742
GO:0098821	Molecular function	BMP receptor activity	IBA	21873635

Protein Information

Protein Name

Activin receptor type-1, TGF-B superfamily receptor type I, activin A receptor, type I, activin A receptor, type II-like kinase 2, activin receptor type I, activin receptor-like kinase 2, hydroxyalkyl-protein kinase, serine/threonine-protein kinase receptor R1

Function

On ligand binding, forms a receptor complex consisting of two type II and two type I transmembrane serine/threonine kinases. Type II receptors phosphorylate and activate type I receptors which autophosphorylate, then bind and activate SMAD transcriptional regulators. Receptor for activin. May be involved for left-right pattern formation during embryogenesis (By similarity).

Refseq Proteins

NP_001096.1, NP_001104537.1, NP_001334592.1, NP_001334593.1, NP_001334594.1, NP_001334595.1, NP_001334596.1

UniProt

Q04771

PDB

3H9R, 3MTF, 3OOM, 3Q4U, 4BGG, 4C02, 4DYM, 5OXG, 5OY6, 6ACR, 6EIX, 6GI6, 6GIN, 6GIP

Pfam

Pfam Accession	Pfam ID
PF01064	Activin_recp
PF07714	Pkinase_Tyr
PF08515	TGF_beta_GS