| |
| |
Gene Symbol |
ACVR1 |
| |
Aliases |
ACTRI, ACVR1A, ACVRLK2, ALK2, FOP, SKR1, TSRI |
| |
Entrez Gene ID |
|
| |
Gene Name |
Activin A receptor type 1 |
| |
Chromosomal Location |
2q24.1 |
| |
HGNC ID |
|
| |
Summary |
Activins are dimeric growth and differentiation factors which belong to the transforming growth factor-beta (TGF-beta) superfamily of structurally related signaling proteins. Activins signal through a heteromeric complex of receptor serine kinases which include at least two type I ( I and IB) and two type II (II and IIB) receptors. These receptors are all transmembrane proteins, composed of a ligand-binding extracellular domain with cysteine-rich region, a transmembrane domain, and a cytoplasmic domain with predicted serine/threonine specificity. Type I receptors are essential for signaling; and type II receptors are required for binding ligands and for expression of type I receptors. Type I and II receptors form a stable complex after ligand binding, resulting in phosphorylation of type I receptors by type II receptors. This gene encodes activin A type I receptor which signals a particular transcriptional response in concert with activin type II receptors. Mutations in this gene are associated with fibrodysplasia ossificans progressive. [provided by RefSeq, Jul 2008]
|
| |
RefSeq DNA |
|
| |
RefSeq mRNA |
|
| |
e!Ensembl
| Gene |
|
|
| Transcript |
ENST00000263640, ENST00000434821, ENST00000409283, ENST00000672582, ENST00000673324, ENST00000424669, ENST00000539637, ENST00000410057, ENST00000412025, ENST00000440523, ENST00000413751 |
|
| Protein |
ENSP00000263640, ENSP00000405004, ENSP00000387273, ENSP00000500605, ENSP00000500109, ENSP00000400767, ENSP00000440091, ENSP00000387127, ENSP00000403006, ENSP00000401189, ENSP00000399322
|
|
|
|
SNPs
| SNP Id |
Upstream Sequence |
SNP |
Downstream Sequence |
Functional Significance |
References |
| rs1220134 |
CTTGAGGATCATATTACTCCAAGAGA |
A/T |
CTATCTGGTCATCAATTTTTATAAT |
Intron variant |
18854405 | |
| rs10497189 |
CCACAATATGCATCAAAATGTGTTCT |
C/T |
GGACATTAGTTATTCTTAATAAAGA |
Intron variant |
18854405 | |
| rs2033962 |
GTGCCATAGACCTTTGGAGGGAGCTC |
G/T |
GAAAGCTGAATTTCCTAATATGAAC |
Intron variant |
18854405 | |
|
| Protein Information |
| |
Protein Name |
Activin receptor type-1, TGF-B superfamily receptor type I, activin A receptor, type I, activin A receptor, type II-like kinase 2, activin receptor type I, activin receptor-like kinase 2, hydroxyalkyl-protein kinase, serine/threonine-protein kinase receptor R1 |
| |
Function |
|
On ligand binding, forms a receptor complex consisting of two type II and two type I transmembrane serine/threonine kinases. Type II receptors phosphorylate and activate type I receptors which autophosphorylate, then bind and activate SMAD transcriptional regulators. Receptor for activin. May be involved for left-right pattern formation during embryogenesis (By similarity). |
|
| |
|
|
| |
UniProt |
|
| |
PDB |
3H9R, 3MTF, 3OOM, 3Q4U, 4BGG, 4C02, 4DYM, 5OXG, 5OY6, 6ACR, 6EIX, 6GI6, 6GIN, 6GIP |
|
|
|
|
|
Interactions |
| | |
| STRING |
MINT |
IntAct |
| ENSP00000286548 |
P50148 |
P50148 |
|
| | |
View interactions
|
| |
| |
Associated Diseases
| Disease group | Disease Name | References |
| Congenital, Hereditary, and Neonatal Diseases and Abnormalities |
| Genetic Diseases |
|
| Endocrine System Diseases |
| PCOS |
|
| Musculoskeletal Diseases |
| Fibrodysplasia Ossificans Progressiva |
16642017, 19330033, 19085907, 21377447, 21567927, 24259422, 18830232, 17272450, 5033743, 21044902, 25741868, 22351757, 7068725, 17351709, 18203193, 818090, 17077940, 10441661, 25326637 |
| Neoplasms |
| Grade I Astrocytoma |
|
| Glioma |
|
| Astrocytoma |
|
| Cerebral Astrocytoma |
|
| Intracranial Astrocytoma |
|
| Gastric Cancer |
|
| Breast Cancer |
|
| Childhood Cerebral Astrocytoma |
|
| Brain Stem Glioma |
|
| Oligoastrocytoma |
|
|
|
References |
| |
|
| |
| PubMed ID |
Associated gene/s |
Associated condition |
Genetic Mutation |
Diagnostic Criteria |
Association with PCOS |
Ethnicity |
Conclusion |
|
AMH |
|
variation in gene |
Rotterdam criteria |
Related
|
359 PCOS patients and 30 normo-ovulatory and 3543 population-based control women |
Genetic variation within ACVR1 is associated with AMH levels and follicle number in PCOS women, suggesting that ALK2 signalling contributes to the disturbed folliculogenesis in PCOS patients. |
|
|
|
|
|
Related
|
PCOS WOMENS (n = 14) and normal controls (n = 21) |
This is the first report to demonstrate the aberrantly increased expression of betaglycan mRNA in PCOS ovaries. The mechanism by which betaglycan contributes to the pathologic process of PCOS remains to be clarified. |
|
|
|
|