AKT2: Polycystic Ovarian Syndrome Database

Gene Information

Gene Symbol

AKT2

Aliases

HIHGHH, PKBB, PKBBETA, PRKBB, RAC-BETA

Entrez Gene ID

208

Gene Name

AKT serine/threonine kinase 2

Chromosomal Location

19q13.2

HGNC ID

HGNC:392

Summary

This gene is a putative oncogene encoding a protein belonging to a subfamily of serine/threonine kinases containing SH2-like (Src homology 2-like) domains, which is involved in signaling pathways. The gene serves as an oncogene in the tumorigenesis of cancer cells For example, its overexpression contributes to the malignant phenotype of a subset of human ductal pancreatic cancers. The encoded protein is a general protein kinase capable of phophorylating several known proteins, and has also been implicated in insulin signaling. [provided by RefSeq, Nov 2019]

RefSeq DNA

NG_012038.2

RefSeq mRNA

NM_001243027.3, NM_001243028.3, NM_001330511.1, NM_001626.6

e!Ensembl

Gene	ENSG00000105221
Transcript	ENST00000392038, ENST00000489375, ENST00000391844, ENST00000476247, ENST00000584288, ENST00000311278, ENST00000497948, ENST00000579047, ENST00000578615, ENST00000578310, ENST00000601166, ENST00000492463, ENST00000491778, ENST00000441941, ENST00000486368, ENST00000596634, ENST00000452077, ENST00000392037, ENST00000416362, ENST00000578123, ENST00000672890, ENST00000423127, ENST00000358335, ENST00000456441, ENST00000583859, ENST00000580747, ENST00000416994, ENST00000427375, ENST00000424901
Protein	ENSP00000375892, ENSP00000470822, ENSP00000375719, ENSP00000463368, ENSP00000462469, ENSP00000309428, ENSP00000472382, ENSP00000471369, ENSP00000463262, ENSP00000462919, ENSP00000472371, ENSP00000462776, ENSP00000463086, ENSP00000396968, ENSP00000463686, ENSP00000470604, ENSP00000404083, ENSP00000375891, ENSP00000407999, ENSP00000462022, ENSP00000500412, ENSP00000403842, ENSP00000351095, ENSP00000396532, ENSP00000462715, ENSP00000463806, ENSP00000392458, ENSP00000403890, ENSP00000399532

SNPs

SNP Id	Upstream Sequence	SNP	Downstream Sequence	Functional Significance	References
rs3730051	GGTGGAGGGAAATTTCAGTGTCATCT	A/G	GTGCCCCTCTCCCTTGAGGCAGGCG	Intron variant	18768676
rs8100018	aaaaaaaaaaaaaaaaaaaGCAGGGG	C/G	CGGGGACAGGGCAGGAGCCCATTCC	Intron variant	18768676

Gene Ontology (GO)

Show/Hide all(30 )

GO ID	Ontology	Function	Evidence	Reference
GO:0006464	Biological process	Cellular protein modification process	TAS	1409633
GO:0007165	Biological process	Signal transduction	TAS	21432781
GO:0008284	Biological process	Positive regulation of cell proliferation	IMP	10983986
GO:0008286	Biological process	Insulin receptor signaling pathway	IMP	16814735
GO:0008286	Biological process	Insulin receptor signaling pathway	TAS	21432781
GO:0010748	Biological process	Negative regulation of plasma membrane long-chain fatty acid transport	IMP	16814735
GO:0010907	Biological process	Positive regulation of glucose metabolic process	IMP	16814735
GO:0010918	Biological process	Positive regulation of mitochondrial membrane potential	IMP	10983986
GO:0018105	Biological process	Peptidyl-serine phosphorylation	IBA	21873635
GO:0030334	Biological process	Regulation of cell migration	TAS	21432781
GO:0030335	Biological process	Positive regulation of cell migration	IDA	25428377
GO:0032000	Biological process	Positive regulation of fatty acid beta-oxidation	IMP	16814735
GO:0032869	Biological process	Cellular response to insulin stimulus	IMP	16814735
GO:0035556	Biological process	Intracellular signal transduction	IBA	21873635
GO:0043066	Biological process	Negative regulation of apoptotic process	IMP	10983986
GO:0045444	Biological process	Fat cell differentiation	TAS	21432781
GO:0045725	Biological process	Positive regulation of glycogen biosynthetic process	IMP	16814735
GO:0046326	Biological process	Positive regulation of glucose import	IMP	16814735
GO:0060644	Biological process	Mammary gland epithelial cell differentiation	TAS	21432781
GO:0071156	Biological process	Regulation of cell cycle arrest	TAS	21432781
GO:2000147	Biological process	Positive regulation of cell motility	IMP	17332325
GO:0005634	Cellular component	Nucleus	IDA	20059950
GO:0005634	Cellular component	Nucleus	TAS	21432781
GO:0005886	Cellular component	Plasma membrane	TAS	21432781
GO:0032991	Cellular component	Protein-containing complex	IDA	10983986
GO:0004674	Molecular function	Protein serine/threonine kinase activity	IBA	21873635
GO:0004674	Molecular function	Protein serine/threonine kinase activity	IDA	10983986, 16540465
GO:0004674	Molecular function	Protein serine/threonine kinase activity	TAS	21432781
GO:0005515	Molecular function	Protein binding	IPI	10490823, 10983986, 12434148, 16417406, 16792529, 17030088, 19713527, 20059950, 20856200, 21291857, 21737686, 22939624, 23823123
GO:0005524	Molecular function	ATP binding	IDA	16540465

Protein Information

Protein Name

RAC-beta serine/threonine-protein kinase, PKB beta, RAC-PK-beta, murine thymoma viral (v-akt) homolog-2, protein kinase Akt-2, protein kinase B beta, putative v-akt murine thymoma viral oncoprotein 2, rac protein kinase beta, v-akt murine thymoma viral oncogene homolog 2

Function

Refseq Proteins

NP_001229956.1, NP_001229957.1, NP_001317440.1, NP_001617.1

UniProt

P31751

PDB

1GZK, 1GZN, 1GZO, 1MRV, 1MRY, 1O6K, 1O6L, 1P6S, 2JDO, 2JDR, 2UW9, 2X39, 2XH5, 3D0E, 3E87, 3E88, 3E8D

Pfam

Pfam Accession	Pfam ID
PF00169	PH
PF00069	Pkinase
PF00433	Pkinase_C