|
|
Gene Symbol |
AMHR2 |
|
Aliases |
AMHR, MISR2, MISRII, MRII |
|
Entrez Gene ID |
|
|
Gene Name |
Anti-Mullerian hormone receptor type 2 |
|
Chromosomal Location |
12q13.13 |
|
HGNC ID |
|
|
Summary |
This gene encodes the receptor for the anti-Mullerian hormone (AMH) which, in addition to testosterone, results in male sex differentiation. AMH and testosterone are produced in the testes by different cells and have different effects. Testosterone promotes the development of male genitalia while the binding of AMH to the encoded receptor prevents the development of the mullerian ducts into uterus and Fallopian tubes. Mutations in this gene are associated with persistent Mullerian duct syndrome type II. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Sep 2009]
|
|
RefSeq DNA |
|
|
RefSeq mRNA |
|
|
e!Ensembl
|
SNPs
SNP Id |
Upstream Sequence |
SNP |
Downstream Sequence |
Functional Significance |
References |
rs2002555 |
TTGTGGGACTTCAGAAGAGAGAAAGA |
C/T |
GTGGGCTGGACATCAAAGAAGGCCT |
-482 A>G |
23969185 | |
|
Protein Information |
|
Protein Name |
Anti-Muellerian hormone type-2 receptor, AMH type II receptor, MIS type II receptor, Muellerian inhibiting substance type II receptor, Mullerian inhibiting substance type II receptor, anti-Muellerian hormone type II receptor, anti-Mullerian hormone receptor, type II |
|
Function |
On ligand binding, forms a receptor complex consisting of two type II and two type I transmembrane serine/threonine kinases. Type II receptors phosphorylate and activate type I receptors which autophosphorylate, then bind and activate SMAD transcriptional regulators. Receptor for anti-Muellerian hormone |
|
|
|
|
|
UniProt |
|
|
|
|
Interactions |
| |
STRING |
MINT |
IntAct |
ENSP00000324856 |
Q15831 |
Q15831 |
|
| |
View interactions
|
|
| |
Associated Diseases
Disease group | Disease Name | References |
Endocrine System Diseases |
PCOS |
|
Reproductive disorders |
Female Urogenital Diseases |
|
Persistent Mullerian Duct Syndrome |
|
|
References |
|
|
|
PubMed ID |
Associated gene/s |
Associated condition |
Genetic Mutation |
Diagnostic Criteria |
Association with PCOS |
Ethnicity |
Conclusion |
|
LH, FSH, Prolactin |
PCOS |
482 A>G polymorphism (rs2002555) |
Rotterdam criteria |
Related
|
858 Caucasian Greek women with PCOS and 309 healthy control women |
In this study, the role of the AMHR2 -482 A>G gene polymorphism in the pathogenesis of PCOS was suggested by the association of the variant with PCOS risk. |
|
LH |
PCOS |
|
Rotterdam criteria |
Related
|
30 women as controls and 21 normo-ovulatory and 19 oligo/anovulatory patients as PCOS group |
The overexpression of AMH and AMHR-II in oligo/anovulatory PCOS women could be due to increased LH levels and/or inhibition of its repressive action. The fact that this dysregulation is observed in oligo/anovulatory, but not in normo-ovulatory, PCOS women emphasizes the role of LH in the follicular arrest of PCOS women and suggests that this involves the AMH/AMHR-II system. |
|
|
|
|