|
|
Gene Symbol |
CYP11A1 |
|
Aliases |
CYP11A, CYPXIA1, P450SCC |
|
Entrez Gene ID |
|
|
Gene Name |
Cytochrome P450 family 11 subfamily A member 1 |
|
Chromosomal Location |
15q24.1 |
|
HGNC ID |
|
|
Summary |
This gene encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. This protein localizes to the mitochondrial inner membrane and catalyzes the conversion of cholesterol to pregnenolone, the first and rate-limiting step in the synthesis of the steroid hormones. Two transcript variants encoding different isoforms have been found for this gene. The cellular location of the smaller isoform is unclear since it lacks the mitochondrial-targeting transit peptide. [provided by RefSeq, Jul 2008]
|
|
RefSeq DNA |
|
|
RefSeq mRNA |
|
|
e!Ensembl
Gene |
|
|
Transcript |
ENST00000358632, ENST00000268053, ENST00000435365, ENST00000566674, ENST00000450547, ENST00000569662, ENST00000416978, ENST00000672913, ENST00000672385, ENST00000671845, ENST00000672176, ENST00000671982, ENST00000672874, ENST00000672585 |
|
Protein |
ENSP00000351455, ENSP00000268053, ENSP00000391081, ENSP00000456941, ENSP00000402064, ENSP00000456598, ENSP00000388018, ENSP00000499849, ENSP00000500767, ENSP00000500401, ENSP00000500857, ENSP00000500308, ENSP00000500644, ENSP00000500435
|
|
|
SNPs
SNP Id |
Upstream Sequence |
SNP |
Downstream Sequence |
Functional Significance |
References |
rs4077582 |
aaaaaaaaaaaaaaaaaaaGCAGGGG |
C/G |
CGGGGACAGGGCAGGAGCCCATTCC |
|
20450755, 22699877 | |
|
|
D15S1546 |
|
Microsatellite |
20450755 | |
|
|
D15S1547 |
|
Microsatellite |
20450755 | |
rs11632698 |
GAGGGCCAGGAACTGATATTCTTAGA |
A/G |
CCCTTTGTGTAACTTTCAGTCTCTC |
Intron variant |
20450755 | |
rs4887139 |
ACTGACCGCCTCCCCAGAAGTGGCCC |
A/G |
GGCTGGAGGTTATTGCCTCATCCTC |
Upstream variant 2KB |
20450755 | |
rs1843090 |
cttcatcctctccatttacataaggc |
A/G |
tatggaattaaccaatggaatgctc |
Intron variant |
20450755 | |
|
|
D16S520 |
|
Microsatellite |
20450755 | |
|
|
Microsatellite [TTTA]n repeat |
|
|
23852617 | |
|
Protein Information |
|
Protein Name |
Cholesterol side-chain cleavage enzyme, mitochondrial, cholesterol 20-22 desmolase, cholesterol monooxygenase (side-chain cleaving), cytochrome P450 11A1, cytochrome P450 family 11 subfamily A polypeptide 1, cytochrome P450(scc), cytochrome P450, subfamily XIA (cholesterol side chain cleavage), steroid 20-22-lyase |
|
Function |
A cytochrome P450 monooxygenase that catalyzes the side-chain hydroxylation and cleavage of cholesterol to pregnenolone, the precursor of most steroid hormones (PubMed:21636783). Catalyzes three sequential oxidation reactions of cholesterol, namely the hydroxylation at C22 followed with the hydroxylation at C20 to yield 20R,22R-hydroxycholesterol that is further cleaved between C20 and C22 to yield the C21-steroid pregnenolone and 4-methylpentanal (PubMed:21636783). Mechanistically, uses molecular oxygen inserting one oxygen atom into a substrate and reducing the second into a water molecule. Two electrons are provided by NADPH via a two-protein mitochondrial transfer system comprising flavoprotein FDXR (adrenodoxin/ferredoxin reductase) and nonheme iron-sulfur protein FDX1 or FDX2 (adrenodoxin/ferredoxin) |
|
|
|
|
|
UniProt |
|
|
PDB |
|
|
Pfam |
Pfam Accession |
Pfam ID |
PF00067 |
p450 |
|
|
|
|
Interactions |
| |
STRING |
MINT |
IntAct |
ENSP00000354511 |
P21964 |
P21964 |
|
| |
View interactions
|
|
| |
Associated Diseases
Disease group | Disease Name | References |
Congenital, Hereditary, and Neonatal Diseases and Abnormalities |
Atonic seizures |
|
Endocrine System Diseases |
Disorders of Sex Development |
|
Congenital adrenal hyperplasia |
|
Adrenal Insufficiency |
|
Gonadal Dysgenesis, 46,XY |
|
Pseudohermaphroditism |
|
PCOS |
|
Neoplasms |
Endometrial Cancer |
|
Nervous System Diseases |
Seizures |
|
Jacksonian Seizure |
|
|
References |
|
|
|
PubMed ID |
Associated gene/s |
Associated condition |
Genetic Mutation |
Diagnostic Criteria |
Association with PCOS |
Ethnicity |
Conclusion |
|
CYP17 |
hyperandrogenic |
A2/A2 genotype |
|
Related
|
65 patients and 58 age matched healthy controls |
The results suggest that both alleles play a minor role in the development of PCOS and could be a genetic risk marker of the hyperandrogenic phenotype. |
|
CYP17,androstenedione,17alpha-hydroxyprogesterone, and DHEAS |
|
Polymorphism in CYP11A1 promoter |
Rotterdam criteria |
Related
|
India-100 PCOS and 100 controls |
The study carried out in a defined group of Indian women with PCOS suggests for the first time an individual, as well as combined, association of polymorphisms in CYP11A1 and CYP17 promoters with T levels. |
|
|
|
SNP rs4077582 |
|
Related
|
314 PCOS patients and 314 controls |
SNP rs4077582 in CYP11A1 is strongly associated with susceptibility to PCOS and may alter the testosterone levels by the regulation of LH in different genotypes. No association was observed in rs11632698. |
|
|
|
|
|
Related
|
290 PCOS and 344 controls |
The polymorphism of CYP11A1 gene was associated with PCOS, however, the relationship between gene sequence covered by tSNP/microsatellite markers and hyperandrogenism of PCOS should be further investigated. |
|
|
|
|
|
Related
|
256 PCOS and 109 healthy control women |
Despite of some associations found, it seems that the promoter variability of CYP11A1 does not play a key role in the pathogenesis of PCOS. |
|
|
|
|
Rotterdam criteria |
Related
|
201 Chinese Han women with (PCOS) and 147 control |
A (tttta)n microsatellite polymorphism in the promoter of CYP11a gene was investigated in 201 Chinese Han women with polycystic ovary syndrome (PCOS) and 147 control women. |
|
Serum Testosteron |
|
|
Rotterdam criteria |
Related
|
371 PCOS patients of United Kingdom origin |
The studies indicate that the strength of, and indeed the existence of, associations between CYP11A promoter variation and androgen-related phenotypes has been substantially overestimated in previous studies. |
|
CYP19 |
|
|
|
Related
|
PCOS in 20 multiply-affected families |
The data demonstrate that variation in CYP11a may play an important role in the aetiology of hyperandrogenaemia which is a common characteristic of polycystic ovary syndrome. |
|
UCP2 |
Hyperandrogenaemia |
|
|
Related
|
|
In conclusion, in PCOS patients, there was a correlation between UCP-2 and CYP11A1 expression, which was significantly higher than in the control group |
|
UCP-2 |
|
|
|
Related
|
12 PCOS patients and 12 controls |
In conclusion, in PCOS patients, there was a correlation between UCP-2 and CYP11A1 expression, which was significantly higher than in the control group. These changes in UCP-2 and CYP11A1 expression may mediate follicle development in PCOS. |
|
|
|
|