|
|
Gene Symbol |
CYP19A1 |
|
Aliases |
ARO, ARO1, CPV1, CYAR, CYP19, CYPXIX, P-450AROM |
|
Entrez Gene ID |
|
|
Gene Name |
Cytochrome P450 family 19 subfamily A member 1 |
|
Chromosomal Location |
15q21.2 |
|
HGNC ID |
|
|
Summary |
This gene encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. This protein localizes to the endoplasmic reticulum and catalyzes the last steps of estrogen biosynthesis. Mutations in this gene can result in either increased or decreased aromatase activity; the associated phenotypes suggest that estrogen functions both as a sex steroid hormone and in growth or differentiation. Alternative promoter use and alternative splicing results in multiple transcript variants that have different tissue specificities. [provided by RefSeq, Dec 2016]
|
|
RefSeq DNA |
|
|
RefSeq mRNA |
NM_031226.3, NM_000103.4, NM_001347248.1, NM_001347249.2, NM_001347250.1, NM_001347251.1, NM_001347252.1, NM_001347253.1, NM_001347254.1, NM_001347255.2, NM_001347256.2 |
|
e!Ensembl
Gene |
|
|
Transcript |
ENST00000396402, ENST00000396404, ENST00000559878, ENST00000559653, ENST00000557934, ENST00000439712, ENST00000561075, ENST00000558328, ENST00000453807, ENST00000405913, ENST00000557858, ENST00000559980, ENST00000405011, ENST00000559646, ENST00000613097 |
|
Protein |
ENSP00000379683, ENSP00000379685, ENSP00000453149, ENSP00000452667, ENSP00000454004, ENSP00000390614, ENSP00000454039, ENSP00000453280, ENSP00000391139, ENSP00000383930, ENSP00000452627, ENSP00000452872, ENSP00000384389, ENSP00000453318, ENSP00000479587
|
|
|
SNPs
SNP Id |
Upstream Sequence |
SNP |
Downstream Sequence |
Functional Significance |
References |
rs700519 |
TAGAAGTTCTGATAGCAGAAAAAAGA |
C/T |
GCAGGATTTCCACAGAAGAGAAACT |
R264C |
21282199 | |
rs710059 |
TAGAAGTTCTGATAGCAGAAAAAAGA |
C/T |
GCAGGATTTCCACAGAAGAGAAACT |
Intron variant |
21282199 | |
|
Protein Information |
|
Protein Name |
Aromatase, cytochrome P-450AROM, cytochrome P450 19A1, cytochrome P450, family 19, subfamily A, polypeptide 1, cytochrome P450, subfamily XIX (aromatization of androgens), estrogen synthase, estrogen synthetase, flavoprotein-linked monooxygenase, microsomal monooxygenase |
|
Function |
A cytochrome P450 monooxygenase that catalyzes the conversion of C19 androgens, androst-4-ene-3,17-dione (androstenedione) and testosterone to the C18 estrogens, estrone and estradiol, respectively. Catalyzes three successive oxidations of C19 androgens: two conventional oxidations at C19 yielding 19-hydroxy and 19-oxo/19-aldehyde derivatives, followed by a third oxidative aromatization step that involves C1-beta hydrogen abstraction combined with cleavage of the C10-C19 bond to yield a phenolic A ring and formic acid (PubMed:20385561). Alternatively, the third oxidative reaction yields a 19-norsteroid and formic acid. Converts dihydrotestosterone to delta1,10-dehydro 19-nordihydrotestosterone and may play a role in homeostasis of this potent androgen. Also displays 2-hydroxylase activity toward estrone. Mechanistically, uses molecular oxygen inserting one oxygen atom into a substrate, and reducing the second into a water molecule, with two electrons provided by NADPH via cytochrome P450 reductase (CPR; NADPH-ferrihemoprotein reductase) |
|
|
|
NP_112503.1, NP_000094.2, NP_001334177.1, NP_001334178.1, NP_001334179.1, NP_001334180.1, NP_001334181.1, NP_001334182.1, NP_001334183.1, NP_001334184.1, NP_001334185.1
|
|
UniProt |
|
|
PDB |
1TQA, 3EQM, 3S79, 3S7S, 4GL5, 4GL7, 4KQ8, 5JKV, 5JKW, 5JL6, 5JL7, 5JL9 |
|
Pfam |
Pfam Accession |
Pfam ID |
PF00067 |
p450 |
|
|
|
|
Interactions |
| |
STRING |
MINT |
IntAct |
ENSP00000290866 |
P12821 |
P12821 |
|
| |
View interactions
|
|
| |
Associated Diseases
Disease group | Disease Name | References |
Digestive System Diseases |
Fatty Liver |
|
Endocrine System Diseases |
Hypopituitarism |
|
Aromatase deficiency |
8265607, 24705274, 9211678, 8530621, 1371509, 14715828, 1496995, 9718379, 9177373, 1825497, 12466340, 10566648 |
Sexual Infantilism |
|
Hypogonadism |
|
Genital Infantilism |
|
Ovarian Diseases |
|
PCOS |
|
Musculoskeletal Diseases |
Osteoporosis |
|
Neoplasms |
Breast Cancer |
|
Ovarian Cancer |
|
Prostate cancer |
|
Cribriform Carcinoma |
|
Endometrial Cancer |
|
Adenocarcinoma |
|
Esophagus Neoplasm |
|
Carcinoma |
|
Psychiatric/Brain disorders |
Autistic Disorder |
|
Reproductive disorders |
Endometrioma |
|
Subfertility, Female |
|
Endometriosis |
|
|
References |
|
|
|
PubMed ID |
Associated gene/s |
Associated condition |
Genetic Mutation |
Diagnostic Criteria |
Association with PCOS |
Ethnicity |
Conclusion |
|
|
|
variation in gene |
|
Related
|
132 women with PCOS and 200 with male-factor infertility, as controls |
Potential associations of the CYP19(TTTA)7 allele with ovarian response to standard gonadotrophin stimulation and with assisted reproduction outcome were found in PCOS women, probably due to androgen/estrogen ratio alterations. |
|
|
|
|
|
Related
|
661 individuals [364 polycystic ovary syndrome (PCOS) patients and 297 controls] |
The rs2470152 in CYP19 was not a major etiological factor for PCOS; however, the heterozygous TC genotype may inhibit aromatase activity, resulting in hyperandrogenism, particularly in PCOS patients. |
|
|
Androgen excess and hyperinsulinemia |
|
|
Related
|
31 PCOS patients and 27 BMI-matched women with regular cycles |
CYP19 gene expression in subcutaneous fat of PCOS patient correlated positively with systolic (p = 0.006) and diastolic blood pressure (p = 0.009). Androgen excess and hyperinsulinemia may play a role in the molecular mechanisms that activate aromatase mRNA transcription in abdominal fat tissue. |
|
|
|
|
|
Related
|
123 patients with PCOS and 113 healthy controls |
The most common allele of the tetranucleotide TTTA repeat polymorphism in the forth intron of CYP19 gene in Han Chinese women is 11R, which was different with the previous study in European Caucasians. |
|
|
|
SNP rs2414096 |
Rotterdam criteria |
Related
|
684 individuals (386 PCOS patients and 298 controls) |
SNP rs2414096 in the CYP19 gene is associated with susceptibility to PCOS |
|
|
|
|
NIH/ NICHD criteria |
Related
|
180 women with PCOS and 160 healthy controls of reproductive age |
Although CYP19 may not be a major genetic determinant of PCOS, it may act as a genetic modifier of the hyperandrogenic phenotype of PCOS. The presence of short CYP19(TTTA)n alleles may contribute to prenatal androgenization programming the development of PCOS phenotype in adult life. |
|
SHBG |
|
|
|
Related
|
180 women with PCOS and 160 healthy women of reproductive age |
SHBG and CYP19 genes may have a synergistic role in the developmental programming of PCOS |
|
|
PCOS |
(TTTA) n polymorphism in intron 4 of CYP19 |
|
Related
|
222 PCOS patients (Chinese) and 281 controls (Chinese) |
In conclusion, PCOS patients had a higher frequency of short alleles, albeit this might not strongly affect the risk of PCOS. |
|
|
|
|