CYP1A1: Polycystic Ovarian Syndrome Database

Gene Information

Gene Symbol

CYP1A1

Aliases

AHH, AHRR, CP11, CYP1, CYPIA1, P1-450, P450-C, P450DX

Entrez Gene ID

1543

Gene Name

Cytochrome P450 family 1 subfamily A member 1

Chromosomal Location

15q24.1

HGNC ID

HGNC:2595

Summary

This gene, CYP1A1, encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. This protein localizes to the endoplasmic reticulum and its expression is induced by some polycyclic aromatic hydrocarbons (PAHs), some of which are found in cigarette smoke. The enzyme's endogenous substrate is unknown; however, it is able to metabolize some PAHs to carcinogenic intermediates. The gene has been associated with lung cancer risk. A related family member, CYP1A2, is located approximately 25 kb away from CYP1A1 on chromosome 15. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Jan 2016]

RefSeq DNA

NG_061374.1

RefSeq mRNA

NM_000499.5, NM_001319216.2, NM_001319217.2

e!Ensembl

Gene	ENSG00000140465
Transcript	ENST00000379727, ENST00000567032, ENST00000395049, ENST00000564596, ENST00000569630, ENST00000566503, ENST00000562201, ENST00000617691, ENST00000395048, ENST00000612821
Protein	ENSP00000369050, ENSP00000456585, ENSP00000378489, ENSP00000457668, ENSP00000455051, ENSP00000455846, ENSP00000455340, ENSP00000482863, ENSP00000378488, ENSP00000479744

SNPs

SNP Id	Upstream Sequence	SNP	Downstream Sequence	Functional Significance	References
		MspI		Microsatellite	23852617
rs4646903	GGACTGCAGGGCGCTCACGCTTGCTG	C/T	GAAGTAAGGCGTTTGAAGGTGAGGC	Downstream variant 500B	23848208
rs1048943	GGACTGCAGGGCGCTCACGCTTGCTG	C/T	GAAGTAAGGCGTTTGAAGGTGAGGC	I462F	23848208

Gene Ontology (GO)

Show/Hide all(18 )

GO ID	Ontology	Function	Evidence	Reference
GO:0002933	Biological process	Lipid hydroxylation	IDA	14559847
GO:0006631	Biological process	Fatty acid metabolic process	IDA	15041462
GO:0008202	Biological process	Steroid metabolic process	IDA	14559847
GO:0008210	Biological process	Estrogen metabolic process	IDA	11555828, 12865317
GO:0017144	Biological process	Drug metabolic process	IDA	19219744
GO:0042359	Biological process	Vitamin D metabolic process	IC	15546903
GO:0042572	Biological process	Retinol metabolic process	IDA	10681376
GO:0055114	Biological process	Oxidation-reduction process	IDA	19219744
GO:0071407	Biological process	Cellular response to organic cyclic compound	IDA	23275542
GO:0043231	Cellular component	Intracellular membrane-bounded organelle	IBA	21873635
GO:0004497	Molecular function	Monooxygenase activity	IBA	21873635
GO:0005515	Molecular function	Protein binding	IPI	25416956, 25910212
GO:0008391	Molecular function	Arachidonic acid monooxygenase activity	IDA	15041462
GO:0016491	Molecular function	Oxidoreductase activity	IDA	19219744
GO:0019825	Molecular function	Oxygen binding	TAS	1691986
GO:0070576	Molecular function	Vitamin D 24-hydroxylase activity	IDA	15546903
GO:0101020	Molecular function	Estrogen 16-alpha-hydroxylase activity	IDA	11555828, 14559847
GO:0101021	Molecular function	Estrogen 2-hydroxylase activity	IDA	11555828, 12865317

Protein Information

Protein Name

Cytochrome P450 1A1, aryl hydrocarbon hydroxylase, cytochrome P1-450, dioxin-inducible, cytochrome P450 form 6, cytochrome P450, family 1, subfamily A, polypeptide 1, cytochrome P450, subfamily I (aromatic compound-inducible), polypeptide 1, cytochrome P450-C, cytochrome P450-P1, flavoprotein-linked monooxygenase, hydroperoxy icosatetraenoate dehydratase, xenobiotic monooxygenase

Function

A cytochrome P450 monooxygenase involved in the metabolism of various endogenous substrates, including fatty acids, steroid hormones and vitamins (PubMed:11555828, PubMed:14559847, PubMed:12865317, PubMed:15805301, PubMed:15041462, PubMed:18577768, PubMed:19965576, PubMed:20972997, PubMed:10681376). Mechanistically, uses molecular oxygen inserting one oxygen atom into a substrate, and reducing the second into a water molecule, with two electrons provided by NADPH via cytochrome P450 reductase (NADPH--hemoprotein reductase) (PubMed:11555828, PubMed:14559847, PubMed:12865317, PubMed:15805301, PubMed:15041462, PubMed:18577768, PubMed:19965576, PubMed:20972997, PubMed:10681376). Catalyzes the hydroxylation of carbon-hydrogen bonds. Exhibits high catalytic activity for the formation of hydroxyestrogens from estrone (E1) and 17beta-estradiol (E2), namely 2-hydroxy E1 and E2, as well as D-ring hydroxylated E1 and E2 at the C15-alpha and C16-alpha positions (PubMed:11555828, PubMed:14559847, PubMed:12865317, PubMed:15805301). Displays different regioselectivities for polyunsaturated fatty acids (PUFA) hydroxylation (PubMed:15041462, PubMed:18577768). Catalyzes the epoxidation of double bonds of certain PUFA (PubMed:15041462, PubMed:19965576, PubMed:20972997). Converts arachidonic acid toward epoxyeicosatrienoic acid (EET) regioisomers, 8,9-, 11,12-, and 14,15-EET, that function as lipid mediators in the vascular system (PubMed:20972997). Displays an absolute stereoselectivity in the epoxidation of eicosapentaenoic acid (EPA) producing the 17(R),18(S) enantiomer (PubMed:15041462). May play an important role in all-trans retinoic acid biosynthesis in extrahepatic tissues. Catalyzes two successive oxidative transformation of all-trans retinol to all-trans retinal and then to the active form all-trans retinoic acid (PubMed:10681376). May also participate in eicosanoids metabolism by converting hydroperoxide species into oxo metabolites (lipoxygenase-like reaction, NADPH-independent) (PubMed:21068195).

Refseq Proteins

NP_000490.1, NP_001306145.1, NP_001306146.1

UniProt

P04798

PDB

4I8V, 6DWM, 6DWN

Pfam

Pfam Accession	Pfam ID
PF00067	p450