| |
| |
Gene Symbol |
FABP4 |
| |
Aliases |
A-FABP, AFABP, ALBP, HEL-S-104, aP2 |
| |
Entrez Gene ID |
|
| |
Gene Name |
Fatty acid binding protein 4 |
| |
Chromosomal Location |
8q21.13 |
| |
HGNC ID |
|
| |
Summary |
FABP4 encodes the fatty acid binding protein found in adipocytes. Fatty acid binding proteins are a family of small, highly conserved, cytoplasmic proteins that bind long-chain fatty acids and other hydrophobic ligands. It is thought that FABPs roles include fatty acid uptake, transport, and metabolism. [provided by RefSeq, Jul 2008]
|
| |
e!Ensembl
|
|
SNPs
| SNP Id |
Upstream Sequence |
SNP |
Downstream Sequence |
Functional Significance |
References |
| rs3834363 |
cttcatcctctccatttacataaggc |
A/G |
tatggaattaaccaatggaatgctc |
Upstream variant 2KB |
19844814 | |
|
| Protein Information |
| |
Protein Name |
Fatty acid-binding protein, adipocyte, adipocyte fatty acid binding protein, adipocyte lipid-binding protein, adipocyte-type fatty acid-binding protein, epididymis secretory protein Li 104, fatty acid binding protein 4, adipocyte |
| |
Function |
|
Lipid transport protein in adipocytes. Binds both long chain fatty acids and retinoic acid. Delivers long-chain fatty acids and retinoic acid to their cognate receptors in the nucleus. |
|
| |
UniProt |
|
| |
PDB |
1TOU, 1TOW, 2HNX, 2NNQ, 3FR2, 3FR4, 3FR5, 3P6C, 3P6D, 3P6E, 3P6F, 3P6G, 3P6H, 3Q6L, 3RZY, 4NNS, 4NNT, 5D45, 5D47, 5D48, 5D4A, 5EDB, 5EDC, 5HZ6, 5HZ8, 5Y0F, 5Y0G, 5Y0X, 5Y12, 5Y13, 6AYL |
| |
Pfam |
| Pfam Accession |
Pfam ID |
| PF00061 |
Lipocalin |
|
|
|
|
|
|
Interactions |
| | |
| STRING |
MINT |
IntAct |
| ENSP00000370408 |
Q99626 |
Q99626 |
|
| | |
View interactions
|
| |
| |
Associated Diseases
| Disease group | Disease Name | References |
| Endocrine System Diseases |
| PCOS |
|
| Neoplasms |
| Anaplastic Carcinoma |
|
| Carcinoma |
|
| Psychiatric/Brain disorders |
| Obstructive Sleep Apnea |
|
| Skin and Connective Tissue Diseases |
| Dermatitis |
|
|
|
References |
| |
| |
| Hu Weihong, Qiao Jie |
| Department of Gynecology and Obstetrics, Peking University Third Hospital, Beijing, 100083, China. weihong19@163.com |
| Endocrine. 2011 Oct;40(2):196-202. doi: 10.1007/s12020-011-9495-9. Epub 2011 Jun |
Abstract
Increased expression of adipocyte fatty acid binding protein (FABP4) is associated with type 2 diabetic, high triglycerides, increased lipid peroxidation, and inflammation markers. To study the expression of FABP4 mRNA in granulosa cells of patients with polycystic ovary syndrome (PCOS) and the impact of testosterone, insulin, and PPARgamma agonist rosiglitazone on granulosa cells (GCs), and to investigate the relationship of serum FABP4 levels with clinical characteristics in patients with PCOS. The expression of FABP4 mRNA in GCs of patients with PCOS and normal controls were assayed by RT-PCR. We assessed the level of FABP4 mRNA after treatment with testosterone, insulin, and rosiglitazone in GCs from normal controls. Serum FABP4 were assayed from 96 patients with PCOS (obese and nonobese 48 cases, respectively) and 80 healthy normal controls (obese and the nonobese 40 cases, respectively). The expression of FABP4 mRNA was higher in the GCs of PCOS than that of the controls (P<0.05). FABP4 mRNA expression was up-regulated by testosterone, insulin, and rosiglitazone at different dosages. Serum FABP4 levels were higher in the nonobese PCOS group than that of the nonobese controls (8.9+/-5.1 ng/ml vs. 4.8+/-0.7 ng/ml), and in the obese PCOS group than that of the obese controls (28.2+/-14.0 ng/ml vs. 15.6+/-6.6 ng/ml), respectively (P<0.05). Multiple linear regression analyses showed that serum FABP4 level was independently associated with HOMA-IR, BMI, and testosterone (P<0.05). Increased FABP4 was related to the clinical characteristics of PCOS. |
|
|
|
| |
| © 2019, Biomedical Informatics Centre, NIRRH |
National Institute for Research in Reproductive Health, Jehangir Merwanji Street, Parel, Mumbai-400 012
Tel: 91-22-24192104, Fax No: 91-22-24139412
|
