FST: Polycystic Ovarian Syndrome Database

Follistatin is a single-chain gonadal protein that specifically inhibits follicle-stimulating hormone release. The single FST gene encodes two isoforms, FST317 and FST344 containing 317 and 344 amino acids respectively, resulting from alternative splicing of the precursor mRNA. In a study in which 37 candidate genes were tested for linkage and association with polycystic ovary syndrome (PCOS) or hyperandrogenemia in 150 families, evidence was found for linkage between PCOS and follistatin. [provided by RefSeq, Jul 2008]

RefSeq DNA

NG_028911.1

RefSeq mRNA

NM_013409.3, NM_006350.4

e!Ensembl

Gene	ENSG00000134363
Transcript	ENST00000256759, ENST00000396947, ENST00000504226, ENST00000497789
Protein	ENSP00000256759, ENSP00000380151, ENSP00000426315, ENSP00000426971

SNPs

SNP Id	Upstream Sequence	SNP	Downstream Sequence	Functional Significance	References
rs3797297	TCACGGTTATAAGTACCTATCTCATA	A/C	CTAGCAAGAAATATTTGCAAGTGAT	Intron variant,upstream variant 2KB	17284512

Gene Ontology (GO)

Show/Hide all(8 )

GO ID	Ontology	Function	Evidence	Reference
GO:0000122	Biological process	Negative regulation of transcription by RNA polymerase II	IDA	12702211
GO:0002244	Biological process	Hematopoietic progenitor cell differentiation	IDA	15451575
GO:0032926	Biological process	Negative regulation of activin receptor signaling pathway	IDA	11948405, 12697670
GO:0032926	Biological process	Negative regulation of activin receptor signaling pathway	IMP	12702211
GO:0051798	Biological process	Positive regulation of hair follicle development	IDA	12514121
GO:0005515	Molecular function	Protein binding	IPI	16198295, 17991437, 20860622
GO:0038102	Molecular function	Activin receptor antagonist activity	IMP	12702211
GO:0048185	Molecular function	Activin binding	IPI	12697670

Protein Information

Protein Name

Follistatin, activin-binding protein, follistatin isoform FST317

Function

Binds directly to activin and functions as an activin antagonist. Specific inhibitor of the biosynthesis and secretion of pituitary follicle stimulating hormone (FSH)

Refseq Proteins

NP_037541.1, NP_006341.1

UniProt

P19883

PDB

2B0U, 2P6A, 3HH2, 5JHW

Pfam

Pfam Accession	Pfam ID
PF09289	FOLN
PF07648	Kazal_2

Pathways
	KEGG	Reactome
	TGF-beta signaling pathway	Antagonism of Activin by Follistatin

Interactions

STRING	MINT	IntAct
ENSP00000384708	P23945	P23945

View interactions

Associated Diseases

Show/Hide all(3 )

Disease group	Disease Name	References
Digestive System Diseases
Digestive System Diseases	Liver Failure	12560755
Endocrine System Diseases
Endocrine System Diseases	PCOS	20093255
Neoplasms
	Liver Cancer	12203361, 19363144
	Stomach Cancer	16367923
	Breast Cancer	16298037
	Gastric Cancer	16367923

References

Show/Hide all(15)

PubMed ID	Associated gene/s	Associated condition	Genetic Mutation	Diagnostic Criteria	Association with PCOS	Ethnicity	Conclusion
11549651	inhibin and activin				Related		Insufficient production of inhibin alpha and possibly beta(A)-subunits,but not follistatin,is associated with follicular arrest in PCOS follicles
23265961					Direct	130 PCOS and 120 controls	Methylation levels of CpG sites in theFST promoter and 5'-UTR are not associated with PCOS
23023351				Rotterdam criteria	Related	Indian population (250 PCOS and 299 controls)	Exonic variants of FST gene seems to be dependent on the subjects and its role in the PCOS pathophysiology cannot be established
22693174	Androgen			Rotterdam criteria	Related	239 PCOS and 38 control	High myostatin level was associated with the increased risk of abdominal obesity after further adjusting the androgens and follistatin levels in women with PCOS
19591997	hsCRP			Rotterdam criteria	Related	Taiwanese population (155 PCOS and 37 controls)	Follistatin and hsCRP levels in both the PCOS and control groups were significantly correlated with each other
17284512			SNP rs3797297 from FST	NIH criteria	Related	Caucasian population (173 PCOS and 107 control)	SNP rs3797297 from FST gene was associated with androgenic markers for PCOS
15472207					Related		FS315 is indeed the major circulating FST isoform but is undetectable in follicular fluid samples aspirated from normal women or PCOS
11334920				PCOS was defined by the presence of menstrual dysfunction, hirsutism (defined by a modified Ferriman-Gallwey score >7) with or without increased serum androgens, and exclusion of hyperprolactinemia, thyroid dysfunction, and nonclassic 21-hydroxylase defic	Related	34 PCOS and 15control	Mutations in the coding regions of the follistatin gene do not appear to be related to PCOS
11278215	activin A and inhibin B			Subjects with PCOS were identified by the presence of hyperandrogenaemia, polycystic ovaries on ultrasound and menstrual abnormalities with no recent ovulation as evidenced by progesterone concentrations.	Related	108 PCOS and 20 controls	Higher concentrations of follistatin with lower concentrations of activin A may relate to follicular development and may be partly responsible for the lack of pre-ovular follicle development in PCOS
11134093				PCOS was defined by the presence of menstrual dysfunction, hirsutism (defined by a modified Ferriman-Gallwey score >7) with or without increased serum androgens, and exclusion of hyperprolactinemia, thyroid dysfunction, and nonclassic 21-hydroxylase defic	Related	85 PCOS	Etiology of PCOS from the follistatin gene, if any, are likely to be small.
10871644				The diagnosis of PCOS was based on the clinical features and laboratory examination.	Related	Chinese population (64 PCOS)	PCOS in the local Chinese population is not caused by mutations in the coding regions of the follistatin gene
10411917				An index case was considered affected if she met the following criteria: chronic menstrual irregularity (amenorrhea or six menses per year; ref.27) and hyperandrogenemia (HA), i.e., elevated levels of total testosterone or testosterone not bound to sex	Related	37 PCOS	The study shows how a systematic screen of candidate genes can provide strong evidence for genetic linkage in complex diseases and can identify those genes that should have high (or low) priority for further study.
8567852					Related		Concentration of FSHin the micro-environment may not play a key role in the mechanisms of selection, atresia, and PCOS in women
7962340	inhibin and activin				Related	6 PCOS	Granulosa cells of small antral follicles are less active in polycystic than in normal ovaries with respect to inhibin alpha-subunit and follistatin mRNA expression
23768911	Activin	PCOS		NIH criteria an dnon-NIH criteria	Related	Overweight and obese, premenopausal women with PCOS (n=51, n=26 National Institutes of Health (NIH) and n=25 non-NIH) and without PCOS (n=25 controls)	Follistatin may potentially act as a marker of or be involved in the pathophysiology of both reproductive and metabolic features of PCOS.

Statistics

About BIC

Feedback

Links

Contact Us