| |
| |
Gene Symbol |
GNRHR |
| |
Aliases |
GNRHR1, GRHR, HH7, LHRHR, LRHR |
| |
Entrez Gene ID |
|
| |
Gene Name |
Gonadotropin releasing hormone receptor |
| |
Chromosomal Location |
4q13.2 |
| |
HGNC ID |
|
| |
Summary |
This gene encodes the receptor for type 1 gonadotropin-releasing hormone. This receptor is a member of the seven-transmembrane, G-protein coupled receptor (GPCR) family. It is expressed on the surface of pituitary gonadotrope cells as well as lymphocytes, breast, ovary, and prostate. Following binding of gonadotropin-releasing hormone, the receptor associates with G-proteins that activate a phosphatidylinositol-calcium second messenger system. Activation of the receptor ultimately causes the release of gonadotropic luteinizing hormone (LH) and follicle stimulating hormone (FSH). Defects in this gene are a cause of hypogonadotropic hypogonadism (HH). Alternative splicing results in multiple transcript variants encoding different isoforms. More than 18 transcription initiation sites in the 5' region and multiple polyA signals in the 3' region have been identified for this gene. [provided by RefSeq, Jul 2008]
|
| |
RefSeq DNA |
|
| |
RefSeq mRNA |
|
| |
e!Ensembl
|
|
SNPs
| SNP Id |
Upstream Sequence |
SNP |
Downstream Sequence |
Functional Significance |
References |
| rs1038426 |
GGGGCACAGAGAGAGTCTGGACACGT |
-/G |
GGGGAGTCAGCCGTGTATCATCGGA |
Utr variant 3 prime |
21274726 | |
|
| Protein Information |
| |
Protein Name |
Gonadotropin-releasing hormone receptor, gnRH receptor, gnRH-R, gonadotropin-releasing hormone (type 1) receptor 1, leutinizing hormone releasing horomone receptor, leutinizing-releasing hormone receptor, luliberin receptor, type I GnRH receptor |
| |
Function |
|
Receptor for gonadotropin releasing hormone (GnRH) that mediates the action of GnRH to stimulate the secretion of the gonadotropic hormones luteinizing hormone (LH) and follicle-stimulating hormone (FSH). This receptor mediates its action by association with G-proteins that activate a phosphatidylinositol-calcium second messenger system. Isoform 2 may act as an inhibitor of GnRH-R signaling |
|
| |
|
|
| |
UniProt |
|
| |
Pfam |
| Pfam Accession |
Pfam ID |
| PF00001 |
7tm_1 |
|
|
|
|
|
|
Interactions |
| | |
| STRING |
MINT |
IntAct |
| ENSP00000387662 |
P01275 |
P01275 |
|
| | |
View interactions
|
| |
| |
Associated Diseases
| Disease group | Disease Name | References |
| Endocrine System Diseases |
| Hypogonadism |
11397842, 25077900, 23643382, 10523035, 12679486, 9371856, 10022417, 11397871, 9425890, 10084584, 11994356, 11318785, 10690855, 17235395, 16968799, 10999776, 22745237, 15240592, 1205028, 25741868, 15625238 |
| PCOS |
|
| Neoplasms |
| Adrenal Cancer |
|
| Reproductive disorders |
| Precocious Puberty |
|
|
|
References |
| |
|
| |
| PubMed ID |
Associated gene/s |
Associated condition |
Genetic Mutation |
Diagnostic Criteria |
Association with PCOS |
Ethnicity |
Conclusion |
|
|
Insulin sensitivity |
3'-UTR variant rs1038426 |
|
Related
|
|
In conclusion, our results strongly suggest that common genetic variant in GNRHR contributes to the phenotypic expression of PCOS. |
|
|
|
|