| |
| |
Gene Symbol |
HSD11B1 |
| |
Aliases |
11-DH, 11-beta-HSD1, CORTRD2, HDL, HSD11, HSD11B, HSD11L, SDR26C1 |
| |
Entrez Gene ID |
|
| |
Gene Name |
Hydroxysteroid 11-beta dehydrogenase 1 |
| |
Chromosomal Location |
1q32.2 |
| |
HGNC ID |
|
| |
Summary |
The protein encoded by this gene is a microsomal enzyme that catalyzes the conversion of the stress hormone cortisol to the inactive metabolite cortisone. In addition, the encoded protein can catalyze the reverse reaction, the conversion of cortisone to cortisol. Too much cortisol can lead to central obesity, and a particular variation in this gene has been associated with obesity and insulin resistance in children. Mutations in this gene and H6PD (hexose-6-phosphate dehydrogenase (glucose 1-dehydrogenase)) are the cause of cortisone reductase deficiency. Alternate splicing results in multiple transcript variants encoding the same protein.[provided by RefSeq, May 2011]
|
| |
RefSeq DNA |
|
| |
RefSeq mRNA |
|
| |
e!Ensembl
|
|
SNPs
| SNP Id |
Upstream Sequence |
SNP |
Downstream Sequence |
Functional Significance |
References |
| rs12086634 |
AGAATGGGAAAGGTATCAACCCCAGA |
G/T |
GATTTCTTAATATAGCCATCTCTTG |
Intron variant |
16551740 | |
|
| Protein Information |
| |
Protein Name |
Corticosteroid 11-beta-dehydrogenase isozyme 1, short chain dehydrogenase/reductase family 26C member 1 |
| |
Function |
|
Catalyzes reversibly the conversion of cortisol to the inactive metabolite cortisone. Catalyzes reversibly the conversion of 7-ketocholesterol to 7-beta-hydroxycholesterol. In intact cells, the reaction runs only in one direction, from 7-ketocholesterol to 7-beta-hydroxycholesterol (By similarity) |
|
| |
|
|
| |
UniProt |
|
| |
PDB |
1XU7, 1XU9, 2BEL, 2ILT, 2IRW, 2RBE, 3BYZ, 3BZU, 3CH6, 3CZR, 3D3E, 3D4N, 3D5Q, 3EY4, 3FCO, 3FRJ, 3H6K, 3HFG, 3OQ1, 3PDJ, 3QQP, 3TFQ, 4BB5, 4BB6, 4C7J, 4C7K, 4HFR, 4HX5, 4IJU, 4IJV, 4IJW, 4K1L, 4P38, 4YYZ, 5PGU, 5PGV, 5PGW, 5PGX, 5PGY, 5QII |
| |
Pfam |
| Pfam Accession |
Pfam ID |
| PF00106 |
adh_short |
|
|
|
|
|
|
Interactions |
| | |
| STRING |
MINT |
IntAct |
| ENSP00000276449 |
|
P49675 |
|
| | |
View interactions
|
| |
| |
Associated Diseases
| Disease group | Disease Name | References |
| Cardiovascular Diseases |
| Hypertensive disease |
|
| Endocrine System Diseases |
| Cortisone reductase deficiency |
|
| PCOS |
|
| Immune System Diseases |
| Dermatitis |
|
| Rheumatoid Arthritis |
|
| Nutritional and Metabolic Diseases |
| Hyperglycemia |
|
| Obesity |
|
| Psychiatric/Brain disorders |
| Mental Depression |
|
|
|
References |
| |
|
| |
| PubMed ID |
Associated gene/s |
Associated condition |
Genetic Mutation |
Diagnostic Criteria |
Association with PCOS |
Ethnicity |
Conclusion |
|
|
PCOS |
T-->G in the third intron rs12086634 |
Rotterdam criteria |
Related
|
102 Caucasian PCOS, 98 controls |
Genetic variation in 11beta-HSD1 contributes to enhanced cortisol clearance and compensatory adrenal hyperandrogenism in lean patients with PCOS but may be protective against obesity and some features of the metabolic syndrome |
|
|
PCOS, anovulation |
|
|
Related
|
37 PCOS , 14 normal |
There is decreased inactivation of cortisol in follicles from anovulatory PCOS. This may reflect inhibition of 11HSD1 by androgens and their 7/11-oxy-metabolites, local concentrations of which are increased in PCOS, and may contribute to the block to folliculogenesis seen in PCOS. |
|
CYP17A1 |
|
|
NIH criteria |
Related
|
28 Caucasian PCOS women and 187 Caucasian controls |
|
|
H6PDH, GR |
PCOS |
|
|
Related
|
16 women with PCOS and 18 controls |
Expression of 11 -HSD1 mRNA was increased in the SAT from the women with PCOS, which may contribute to the increased local active glucocorticoids (cortisol), and subsequently affects the secretion of the local adipose tissue |
|
|
obesity,PCOS |
rs846910, rs12086634 |
|
Related
|
20 Caucasian women with PCOS, 20 Caucasian controls |
Tissue-specific dysregulation of HSD11B1 is a feature of PCOS |
|
|
|
rs4844880, rs3753519, rs760951, rs4844880, rs3753519 |
|
Direct
|
58 women with PCOS, 64 controls |
Promoter SNPs of the HSD11B1 gene might exert a potential genetic protective role against the development of PCOS, possibly via their beneficial effect on carbohydrate homeostasis due to facilitation of insulin efflux from pancreatic beta-cells |
|
|
|
|
