|
|
Gene Symbol |
HSD17B6 |
|
Aliases |
HSE, RODH, SDR9C6 |
|
Entrez Gene ID |
|
|
Gene Name |
Hydroxysteroid 17-beta dehydrogenase 6 |
|
Chromosomal Location |
12q13.3 |
|
HGNC ID |
|
|
Summary |
The protein encoded by this gene has both oxidoreductase and epimerase activities and is involved in androgen catabolism. The oxidoreductase activity can convert 3 alpha-adiol to dihydrotestosterone, while the epimerase activity can convert androsterone to epi-androsterone. Both reactions use NAD+ as the preferred cofactor. This gene is a member of the retinol dehydrogenase family. [provided by RefSeq, Aug 2013]
|
|
e!Ensembl
|
SNPs
SNP Id |
Upstream Sequence |
SNP |
Downstream Sequence |
Functional Significance |
References |
rs898611 |
GGGGCACAGAGAGAGTCTGGACACGT |
-/G |
GGGGAGTCAGCCGTGTATCATCGGA |
Intron variant |
21039282, 17070195 | |
|
Protein Information |
|
Protein Name |
17-beta-hydroxysteroid dehydrogenase type 6, 17-beta-HSD 6, 17-beta-hydroxysteroid dehydrogenase type 6 variant 1, 17-beta-hydroxysteroid dehydrogenase type 6 variant 2, 17-beta-hydroxysteroid dehydrogenase type 6 variant 3, 3(alpha->beta)-hydroxysteroid epimerase, 3(alpha->beta)-hydroxysteroid epimerasel, 3-alpha->beta-HSE, 3-hydroxysteroid epimerase, NAD+ -dependent 3 alpha-hydroxysteroid dehydrogenase 3-hydroxysteroid epimerase, hydroxysteroid (17-beta) dehydrogenase 6 homolog, oxidative 3-alpha-hydroxysteroid-dehydrogenase, oxidoreductase, retinol dehydrogenase, short chain dehydrogenase/reductase family 9C member 6 |
|
Function |
NAD-dependent oxidoreductase with broad substrate specificity that shows both oxidative and reductive activity (in vitro). Has 17-beta-hydroxysteroid dehydrogenase activity towards various steroids (in vitro). Converts 5-alpha-androstan-3-alpha,17-beta-diol to androsterone and estradiol to estrone (in vitro). Has 3-alpha-hydroxysteroid dehydrogenase activity towards androsterone (in vitro). Has retinol dehydrogenase activity towards all-trans-retinol (in vitro). Can convert androsterone to epi-androsterone. Androsterone is first oxidized to 5-alpha-androstane-3,17-dione and then reduced to epi-andosterone. Can act on both C-19 and C-21 3-alpha-hydroxysteroids. |
|
|
UniProt |
|
|
Pfam |
Pfam Accession |
Pfam ID |
PF00106 |
adh_short |
|
|
|
|
Interactions |
| |
STRING |
MINT |
IntAct |
ENSP00000348170 |
P00738 |
P00738 |
|
| |
View interactions
|
|
| |
Associated Diseases
Disease group | Disease Name | References |
Endocrine System Diseases |
PCOS |
|
Neoplasms |
Endometrial Cancer |
|
Prostate cancer |
|
Prostate Carcinoma |
|
|
References |
|
|
|
PubMed ID |
Associated gene/s |
Associated condition |
Genetic Mutation |
Diagnostic Criteria |
Association with PCOS |
Ethnicity |
Conclusion |
|
Insulin |
PCOS |
rs898611, rs10459247, rs10876920, |
NIH criteria |
Related
|
335 White women with PCOS and 198 White controls |
Although we did not replicate association between PCOS and rs898611, we replicated associations of this variant and others in HSD17B6 with metabolic traits. These replication data suggest a role for HSD17B6 in PCOS. How HSD17B6, an enzyme involved in steroid metabolism, may influence BMI and insulin resistance in PCOS remains to be determined. |
|
|
|
|