IDE: Polycystic Ovarian Syndrome Database

Gene Information

Gene Symbol

IDE

Aliases

INSULYSIN

Entrez Gene ID

3416

Gene Name

Insulin degrading enzyme

Chromosomal Location

10q23.33

HGNC ID

HGNC:5381

Summary

This gene encodes a zinc metallopeptidase that degrades intracellular insulin, and thereby terminates insulins activity, as well as participating in intercellular peptide signalling by degrading diverse peptides such as glucagon, amylin, bradykinin, and kallidin. The preferential affinity of this enzyme for insulin results in insulin-mediated inhibition of the degradation of other peptides such as beta-amyloid. Deficiencies in this protein's function are associated with Alzheimer's disease and type 2 diabetes mellitus but mutations in this gene have not been shown to be causitive for these diseases. This protein localizes primarily to the cytoplasm but in some cell types localizes to the extracellular space, cell membrane, peroxisome, and mitochondrion. Alternative splicing results in multiple transcript variants encoding distinct isoforms. Additional transcript variants have been described but have not been experimentally verified.[provided by RefSeq, Sep 2009]

RefSeq DNA

NG_013012.1

RefSeq mRNA

NM_004969.4, NR_136399.1, NM_001165946.1, NM_001322793.1, NM_001322794.1, NM_001322795.1, NM_001322796.1, NM_001322797.1

e!Ensembl

Gene	ENSG00000119912
Transcript	ENST00000650060, ENST00000265986, ENST00000478361, ENST00000436178, ENST00000371581
Protein	ENSP00000497272, ENSP00000265986, ENSP00000473506, ENSP00000408850, ENSP00000360637

SNPs

SNP Id	Upstream Sequence	SNP	Downstream Sequence	Functional Significance	References
rs2209972	GGACTGCAGGGCGCTCACGCTTGCTG	C/T	GAAGTAAGGCGTTTGAAGGTGAGGC	Nc transcript variant	17953957

Gene Ontology (GO)

Show/Hide all(49 )

GO ID	Ontology	Function	Evidence	Reference
GO:0006508	Biological process	Proteolysis	IDA	18602473, 20082125, 21185309
GO:0008286	Biological process	Insulin receptor signaling pathway	NAS	3059494
GO:0008340	Biological process	Determination of adult lifespan	IDA	18448515
GO:0010815	Biological process	Bradykinin catabolic process	IDA	17613531, 21185309
GO:0010992	Biological process	Ubiquitin recycling	IDA	21185309
GO:0019885	Biological process	Antigen processing and presentation of endogenous peptide antigen via MHC class I	IMP	20364150
GO:0032461	Biological process	Positive regulation of protein oligomerization	IDA	9830016
GO:0042447	Biological process	Hormone catabolic process	IBA	21873635
GO:0042447	Biological process	Hormone catabolic process	IDA	19321446
GO:0043171	Biological process	Peptide catabolic process	IDA	20364150
GO:0044257	Biological process	Cellular protein catabolic process	IMP	20364150
GO:0045732	Biological process	Positive regulation of protein catabolic process	TAS	22383525
GO:0050435	Biological process	Amyloid-beta metabolic process	IBA	21873635
GO:0050435	Biological process	Amyloid-beta metabolic process	IDA	9830016, 17613531, 26968463
GO:0051260	Biological process	Protein homooligomerization	IDA	17051221
GO:0051603	Biological process	Proteolysis involved in cellular protein catabolic process	IBA	21873635
GO:0051603	Biological process	Proteolysis involved in cellular protein catabolic process	IDA	9830016
GO:0097242	Biological process	Amyloid-beta clearance	IMP	10684867, 16511862
GO:0150094	Biological process	Amyloid-beta clearance by cellular catabolic process	IMP	23525105
GO:1901142	Biological process	Insulin metabolic process	IDA	18448515
GO:1901143	Biological process	Insulin catabolic process	IDA	9231799, 9830016, 19321446
GO:1903715	Biological process	Regulation of aerobic respiration	IGI	23525105
GO:0005615	Cellular component	Extracellular space	IDA	9830016
GO:0005615	Cellular component	Extracellular space	TAS	10684867
GO:0005634	Cellular component	Nucleus	IDA	9231799, 15285718
GO:0005634	Cellular component	Nucleus	IDA	18226493
GO:0005737	Cellular component	Cytoplasm	IDA	9231799, 9830016, 18226493, 23525105
GO:0005739	Cellular component	Mitochondrion	IBA	21873635
GO:0005739	Cellular component	Mitochondrion	IDA	15285718, 23525105
GO:0005777	Cellular component	Peroxisome	IDA	9231799
GO:0005777	Cellular component	Peroxisome	TAS	10684867
GO:0005782	Cellular component	Peroxisomal matrix	IBA	21873635
GO:0005829	Cellular component	Cytosol	IDA	9830016, 15285718, 20364150
GO:0005829	Cellular component	Cytosol	TAS	10684867
GO:0009897	Cellular component	External side of plasma membrane	IDA	16511862
GO:0009986	Cellular component	Cell surface	IDA	16511862, 17055432
GO:0016323	Cellular component	Basolateral plasma membrane	IMP	16511862
GO:0004175	Molecular function	Endopeptidase activity	IDA	20364150
GO:0004222	Molecular function	Metalloendopeptidase activity	IDA	17051221, 17613531
GO:0004222	Molecular function	Metalloendopeptidase activity	TAS	10684867
GO:0005102	Molecular function	Signaling receptor binding	IPI	20178365
GO:0005515	Molecular function	Protein binding	IPI	17055432, 17715127, 20959807
GO:0005524	Molecular function	ATP binding	IDA	17613531
GO:0008270	Molecular function	Zinc ion binding	IDA	17613531, 19321446
GO:0042277	Molecular function	Peptide binding	IPI	20082125
GO:0042803	Molecular function	Protein homodimerization activity	IDA	17613531, 19321446
GO:0043559	Molecular function	Insulin binding	IDA	17051221
GO:0043559	Molecular function	Insulin binding	IPI	20082125
GO:0140036	Molecular function	Ubiquitin-dependent protein binding	IPI	21185309

Protein Information

Protein Name

Insulin-degrading enzyme, Abeta-degrading protease, insulin protease, insulinase

Function

Plays a role in the cellular breakdown of insulin, APP peptides, IAPP peptides, glucagon, bradykinin, kallidin and other peptides, and thereby plays a role in intercellular peptide signaling (PubMed:2293021, PubMed:10684867, PubMed:26968463, PubMed:17051221, PubMed:17613531, PubMed:18986166, PubMed:19321446, PubMed:23922390, PubMed:24847884, PubMed:26394692, PubMed:29596046). Substrate binding induces important conformation changes, making it possible to bind and degrade larger substrates, such as insulin (PubMed:23922390, PubMed:26394692, PubMed:29596046). Contributes to the regulation of peptide hormone signaling cascades and regulation of blood glucose homeostasis via its role in the degradation of insulin, glucagon and IAPP (By similarity). Plays a role in the degradation and clearance of APP-derived amyloidogenic peptides that are secreted by neurons and microglia (PubMed:9830016, PubMed:26394692) (Probable). Involved in antigen processing. Produces both the N terminus and the C terminus of MAGEA3-derived antigenic peptide (EVDPIGHLY) that is presented to cytotoxic T lymphocytes by MHC class I. .; (Microbial infection) The membrane-associated isoform acts as an entry receptor for varicella-zoster virus (VZV).

Refseq Proteins

NP_004960.2, , NP_001159418.1, NP_001309722.1, NP_001309723.1, NP_001309724.1, NP_001309725.1, NP_001309726.1

UniProt

P14735

PDB

2G47, 2WK3, 4M1C, 3N56, 3N57, 3H44, 4RAL, 2G49, 6EDS, 2G48, 3HGZ, 2G54, 2G56, 2JBU, 2JG4, 2WBY, 2WC0, 2YPU, 3CWW, 3E4A, 3E4Z, 3E50, 3OFI, 3QZ2, 4DTT, 4DWK, 4GS8, 4GSC, 4GSF, 4IFH, 4IOF, 4LTE, 4NXO, 4PES, 4PF7, 4PF9, 4PFC, 4QIA, 4RE9, 5CJO, 5UOE, 5WOB, 6B3Q, 6B70, 6B7Y, 6B7Z, 6BF6, 6BF7, 6BF8, 6BF9, 6BFC,

Pfam

Pfam Accession	Pfam ID
PF00675	Peptidase_M16
PF05193	Peptidase_M16_C
PF16187	Peptidase_M16_M

IDE

Association of genetic variants of insulin degrading enzyme with metabolic features in women with polycystic ovary syndrome.