|
|
Gene Symbol |
IRS4 |
|
Aliases |
CHNG9, IRS-4, PY160 |
|
Entrez Gene ID |
|
|
Gene Name |
Insulin receptor substrate 4 |
|
Chromosomal Location |
Xq22.3 |
|
HGNC ID |
|
|
Summary |
IRS4 encodes the insulin receptor substrate 4, a cytoplasmic protein that contains many potential tyrosine and serine/threonine phosphorylation sites. Tyrosine-phosphorylated IRS4 protein has been shown to associate with cytoplasmic signalling molecules that contain SH2 domains. The IRS4 protein is phosphorylated by the insulin receptor tyrosine kinase upon receptor stimulation.. [provided by RefSeq, Jul 2008]
|
|
RefSeq DNA |
|
|
RefSeq mRNA |
|
|
e!Ensembl
|
SNPs
SNP Id |
Upstream Sequence |
SNP |
Downstream Sequence |
Functional Significance |
References |
rs1865434 |
GAGTCGATGAGGGTGTGCTCCATGGT |
C/T |
GGTCTTCCTTGCCAGCTGATGCCCA |
Utr variant 3 prime |
21300347 | |
|
Protein Information |
|
Protein Name |
Insulin receptor substrate 4, 160 kDa phosphotyrosine protein, phosphoprotein of 160 kDa, pp160 |
|
Function |
Acts as an interface between multiple growth factor receptors possessing tyrosine kinase activity, such as insulin receptor, IGF1R and FGFR1, and a complex network of intracellular signaling molecules containing SH2 domains. Involved in the IGF1R mitogenic signaling pathway. Promotes the AKT1 signaling pathway and BAD phosphorylation during insulin stimulation without activation of RPS6KB1 or the inhibition of apoptosis. Interaction with GRB2 enhances insulin-stimulated mitogen-activated protein kinase activity. May be involved in nonreceptor tyrosine kinase signaling in myoblasts. Plays a pivotal role in the proliferation/differentiation of hepatoblastoma cell through EPHB2 activation upon IGF1 stimulation. May play a role in the signal transduction in response to insulin and to a lesser extent in response to IL4 and GH on mitogenesis. Plays a role in growth, reproduction and glucose homeostasis. May act as negative regulators of the IGF1 signaling pathway by suppressing the function of IRS1 and IRS2. |
|
|
|
|
|
UniProt |
|
|
|
|
Interactions |
| |
STRING |
MINT |
IntAct |
ENSP00000356162 |
|
|
|
| |
View interactions
|
|
| |
Associated Diseases
Disease group | Disease Name | References |
Endocrine System Diseases |
PCOS |
|
Hypothyroidism |
|
Neoplasms |
Skin Cancer |
|
Uterine Fibroids |
|
Pancreatic Neoplasm |
|
Meningioma |
|
|
References |
|
|
|
PubMed ID |
Associated gene/s |
Associated condition |
Genetic Mutation |
Diagnostic Criteria |
Association with PCOS |
Ethnicity |
Conclusion |
|
|
hyperandrogenism and thecal hyperplasia |
|
Women with PCOS were identified based on a history of oligo/amenorrhoea, hirsutism, and typical morphological appearance of polycystic ovaries (normal or enlarged ovarian volume with multiple subcapsular cysts (8mm in diameter) at laparotomy or laparosco |
Related
|
11 women with PCOS and 10 regularly cycling control women |
The data demonstrates cell-specific alterations in IRS protein concentrations in theca cells from polycystic ovaries that are consistent with an exaggerated amplification of the insulin signal and which may play an important role in ovarian hyperandrogenism and thecal hyperplasia. |
|
|
|
|