|
|
Gene Symbol |
LHB |
|
Aliases |
CGB4, HH23, LSH-B, LSH-beta |
|
Entrez Gene ID |
|
|
Gene Name |
Luteinizing hormone subunit beta |
|
Chromosomal Location |
19q13.33 |
|
HGNC ID |
|
|
Summary |
This gene is a member of the glycoprotein hormone beta chain family and encodes the beta subunit of luteinizing hormone (LH). Glycoprotein hormones are heterodimers consisting of a common alpha subunit and an unique beta subunit which confers biological specificity. LH is expressed in the pituitary gland and promotes spermatogenesis and ovulation by stimulating the testes and ovaries to synthesize steroids. The genes for the beta chains of chorionic gonadotropin and for luteinizing hormone are contiguous on chromosome 19q13.3. Mutations in this gene are associated with hypogonadism which is characterized by infertility and pseudohermaphroditism. [provided by RefSeq, Jul 2008]
|
|
RefSeq DNA |
|
|
RefSeq mRNA |
|
|
e!Ensembl
|
SNPs
SNP Id |
Upstream Sequence |
SNP |
Downstream Sequence |
Functional Significance |
References |
rs1800447 |
TTGTGGGACTTCAGAAGAGAGAAAGA |
C/T |
GTGGGCTGGACATCAAAGAAGGCCT |
W28R |
25111116 | |
rs34349826 |
TTGTGGGACTTCAGAAGAGAGAAAGA |
C/T |
GTGGGCTGGACATCAAAGAAGGCCT |
I35T |
25111116 | |
|
Protein Information |
|
Protein Name |
Lutropin subunit beta, interstitial cell stimulating hormone, beta chain, luteinizing hormone beta polypeptide, luteinizing hormone beta subunit, lutropin beta chain |
|
Function |
Promotes spermatogenesis and ovulation by stimulating the testes and ovaries to synthesize steroids |
|
|
|
|
|
UniProt |
|
|
PDB |
|
|
Pfam |
Pfam Accession |
Pfam ID |
PF00007 |
Cys_knot |
|
|
|
|
Interactions |
| |
STRING |
MINT |
IntAct |
ENSP00000305852 |
P48230 |
P48230 |
|
| |
View interactions
|
|
| |
Associated Diseases
Disease group | Disease Name | References |
Cardiovascular Diseases |
Hypertensive disease |
|
Endocrine System Diseases |
Hypogonadism |
|
Hyperprolactinemia |
|
Isolated lutropin deficiency |
|
Precocious Puberty |
|
PCOS |
|
Neoplasms |
Ovarian Cancer |
|
Leydig Cell Tumor |
|
Reproductive disorders |
Subfertility, Female |
|
Male infertility |
|
Preeclampsia |
|
|
References |
|
|
|
PubMed ID |
Associated gene/s |
Associated condition |
Genetic Mutation |
Diagnostic Criteria |
Association with PCOS |
Ethnicity |
Conclusion |
|
|
|
SNP in exon 3 (rs#1056917) of LH gene |
|
Related
|
South-Indian-250 PCOS and 299 controls |
The LH variants that are found to be more frequent among PCOS cases are silent in nature and not of any functional significance, they might influence other significant functional polymorphisms in the hypothalamic-pituitary-gonadal axis which needs to be explored. |
|
|
PCOS |
|
|
Related
|
50 PCOS, 30 controls |
Women with the PCOS had significantly higher mean arterial pressure (MAP), serum TAG, LDL-C, insulin, and LH levels when compared with the age-matched control subjects |
|
|
|
|
|
Related
|
40 (20 PCO, 10 chronic anovulation, 10 controls) |
This data suggest that bioactive LH may be an important hormonal marker in the clinical diagnosis of PCO |
|
|
|
|