|
|
Gene Symbol |
LPIN1 |
|
Aliases |
PAP1 |
|
Entrez Gene ID |
|
|
Gene Name |
Lipin 1 |
|
Chromosomal Location |
2p25.1 |
|
HGNC ID |
|
|
Summary |
This gene encodes a magnesium-ion-dependent phosphatidic acid phosphohydrolase enzyme that catalyzes the penultimate step in triglyceride synthesis including the dephosphorylation of phosphatidic acid to yield diacylglycerol. Expression of this gene is required for adipocyte differentiation and it also functions as a nuclear transcriptional coactivator with some peroxisome proliferator-activated receptors to modulate expression of other genes involved in lipid metabolism. Mutations in this gene are associated with metabolic syndrome, type 2 diabetes, acute recurrent rhabdomyolysis, and autosomal recessive acute recurrent myoglobinuria (ARARM). This gene is also a candidate for several human lipodystrophy syndromes. [provided by RefSeq, Mar 2017]
|
|
RefSeq DNA |
|
|
RefSeq mRNA |
NM_145693.4, NR_146080.2, NM_001261427.2, NM_001261428.3, NM_001349199.2, NM_001349200.2, NM_001349201.2, NM_001349202.2, NM_001349203.2, NM_001349204.2, NM_001349205.1, NM_001349206.2, NM_001349207.2, NM_001349208.2 |
|
e!Ensembl
|
SNPs
SNP Id |
Upstream Sequence |
SNP |
Downstream Sequence |
Functional Significance |
References |
rs11693809 |
GAGCTGATTTGCATTGGCTCACAAAG |
C/T |
TGACCACAGACCCTGCATGGGAGAC |
Intron variant |
21448847 | |
|
Protein Information |
|
Protein Name |
Phosphatidate phosphatase LPIN1 |
|
Function |
Plays important roles in controlling the metabolism of fatty acids at different levels. Acts as a magnesium-dependent phosphatidate phosphatase enzyme which catalyzes the conversion of phosphatidic acid to diacylglycerol during triglyceride, phosphatidylcholine and phosphatidylethanolamine biosynthesis in the reticulum endoplasmic membrane. Acts also as a nuclear transcriptional coactivator for PPARGC1A/PPARA to modulate lipid metabolism gene expression (By similarity). Is involved in adipocyte differentiation. May also be involved in mitochondrial fission by converting phosphatidic acid to diacylglycerol |
|
|
|
NP_663731.1, , NP_001248356.1, NP_001248357.1, NP_001336128.1, NP_001336129.1, NP_001336130.1, NP_001336131.1, NP_001336132.1, NP_001336133.1, NP_001336134.1, NP_001336135.1, NP_001336136.1, NP_001336137.1
|
|
UniProt |
|
|
|