| |
| |
Gene Symbol |
MTNR1B |
| |
Aliases |
FGQTL2, MEL-1B-R, MT2 |
| |
Entrez Gene ID |
|
| |
Gene Name |
Melatonin receptor 1B |
| |
Chromosomal Location |
11q14.3 |
| |
HGNC ID |
|
| |
Summary |
This gene encodes one of two high affinity forms of a receptor for melatonin, the primary hormone secreted by the pineal gland. This gene product is an integral membrane protein that is a G-protein coupled, 7-transmembrane receptor. It is found primarily in the retina and brain although this detection requires RT-PCR. It is thought to participate in light-dependent functions in the retina and may be involved in the neurobiological effects of melatonin. [provided by RefSeq, Jul 2008]
|
| |
RefSeq DNA |
|
| |
RefSeq mRNA |
|
| |
e!Ensembl
|
|
SNPs
| SNP Id |
Upstream Sequence |
SNP |
Downstream Sequence |
Functional Significance |
References |
| rs10830963 |
AGTGATGCTAAGAATTCACACCATCT |
C/G |
CTATCCAGAACCAGTAACTGCCTGG |
Intron variant |
20959387 | |
|
| Protein Information |
| |
Protein Name |
Melatonin receptor type 1B, mel1b receptor, melatonin receptor 1B variant b, melatonin receptor MEL1B |
| |
Function |
|
High affinity receptor for melatonin. Likely to mediate the reproductive and circadian actions of melatonin. The activity of this receptor is mediated by pertussis toxin sensitive G proteins that inhibit adenylate cyclase activity |
|
| |
|
|
| |
UniProt |
|
| |
Pfam |
| Pfam Accession |
Pfam ID |
| PF00001 |
7tm_1 |
|
|
|
|
|
|
Interactions |
| | |
| STRING |
MINT |
IntAct |
| ENSP00000370129 |
|
P52895 |
|
| | |
View interactions
|
| |
| |
Associated Diseases
| Disease group | Disease Name | References |
| Ear Or Mastoid Diseases |
| Meniere Disease |
|
| Endocrine System Diseases |
| Diabetes Mellitus |
|
| PCOS |
|
| Neoplasms |
| Ovarian Cancer |
|
| Psychiatric/Brain disorders |
| Autistic Disorder |
|
| Schizophrenia |
|
|
|
References |
| |
|
| |
| PubMed ID |
Associated gene/s |
Associated condition |
Genetic Mutation |
Diagnostic Criteria |
Association with PCOS |
Ethnicity |
Conclusion |
|
|
|
SNP, rs10830963 in MTNR1B |
Rotterdam criteria |
Related
|
526 patients with PCOS and 547 healthy Chinese Han women |
SNP, rs10830963, in the MTNR1B gene is not only associated with susceptibility to PCOS, but also contributes to the PCOS phenotype |
|
|
serum testosterone, glucose tolerance, insulin secretion |
|
Rotterdam criteria |
Related
|
|
MTNR1B mediating some functions of melatonin contributes to the phenotypic expression ofpolycystic ovary syndrome, which provide a new insight into the role of MTNR1B gene in the pathophysiology of the disease. |
|
|
|
|