| |
| |
Gene Symbol |
POMC |
| |
Aliases |
ACTH, CLIP, LPH, MSH, NPP, OBAIRH, POC |
| |
Entrez Gene ID |
|
| |
Gene Name |
Proopiomelanocortin |
| |
Chromosomal Location |
2p23.3 |
| |
HGNC ID |
|
| |
Summary |
This gene encodes a preproprotein that undergoes extensive, tissue-specific, post-translational processing via cleavage by subtilisin-like enzymes known as prohormone convertases. There are eight potential cleavage sites within the preproprotein and, depending on tissue type and the available convertases, processing may yield as many as ten biologically active peptides involved in diverse cellular functions. The encoded protein is synthesized mainly in corticotroph cells of the anterior pituitary where four cleavage sites are used; adrenocorticotrophin, essential for normal steroidogenesis and the maintenance of normal adrenal weight, and lipotropin beta are the major end products. In other tissues, including the hypothalamus, placenta, and epithelium, all cleavage sites may be used, giving rise to peptides with roles in pain and energy homeostasis, melanocyte stimulation, and immune modulation. These include several distinct melanotropins, lipotropins, and endorphins that are contained within the adrenocorticotrophin and beta-lipotropin peptides. The antimicrobial melanotropin alpha peptide exhibits antibacterial and antifungal activity. Mutations in this gene have been associated with early onset obesity, adrenal insufficiency, and red hair pigmentation. Alternatively spliced transcript variants encoding the same protein have been described. [provided by RefSeq, Jan 2016]
|
| |
RefSeq DNA |
|
| |
RefSeq mRNA |
|
| |
e!Ensembl
|
|
SNPs
| SNP Id |
Upstream Sequence |
SNP |
Downstream Sequence |
Functional Significance |
References |
| rs12473543 |
AAGGAATAGTTTGGGAAGCTAAAGAT |
G/T |
TAAAGTACAGAATAGATTGAGGGGT |
Intron variant |
20200332 | |
|
| Protein Information |
| |
Protein Name |
Pro-opiomelanocortin, adrenocorticotropic hormone, adrenocorticotropin, alpha-MSH, alpha-melanocyte-stimulating hormone, beta-LPH, beta-MSH, beta-endorphin, beta-melanocyte-stimulating hormone, corticotropin-like intermediary peptide, corticotropin-lipotropin, gamma-LPH, gamma-MSH, lipotropin beta, lipotropin gamma, melanotropin alpha, melanotropin beta, melanotropin gamma, met-enkephalin, opiomelanocortin prepropeptide, pro-ACTH-endorphin, proopiomelanocortin preproprotein |
| |
Function |
|
[Corticotropin]: Stimulates the adrenal glands to release cortisol.; [Melanocyte-stimulating hormone alpha]: Anorexigenic peptide. Increases the pigmentation of skin by increasing melanin production in melanocytes.; [Melanocyte-stimulating hormone beta]: Increases the pigmentation of skin by increasing melanin production in melanocytes.; [Beta-endorphin]: Endogenous orexigenic opiate.; [Met-enkephalin]: Endogenous opiate |
|
| |
|
|
| |
UniProt |
|
| |
PDB |
|
|
|
|
|
|
Interactions |
| | |
| STRING |
MINT |
IntAct |
| ENSP00000380432 |
P01308 |
P01308 |
|
| | |
View interactions
|
| |
| |
Associated Diseases
| Disease group | Disease Name | References |
| Cardiovascular Diseases |
| Hypertensive disease |
17954371, 3015460, 17324744, 6100240, 11703388, 19153526, 18487447, 1330390, 76749, 16053986, 187612, 216942, 8261660, 6283272, 1664305, 1316127, 9535146, 6274577, 16243970, 15132301, 11560123, 18067589, 10474778, 12887135, 11132610, 6135010, 17994356, 16546835, 9056691, 16620303, 284 |
| Cardiomyopathy |
|
| Myocardial Ischemia |
|
| Heart Failure |
|
| Subaortic stenosis |
|
| Sick Sinus Syndrome |
|
| Sinus Node Dysfunction |
|
| Myocardial Diseases |
|
| Myocardial Failure |
|
| Congenital, Hereditary, and Neonatal Diseases and Abnormalities |
| Atonic seizures |
|
| Catalepsy |
|
| Genetic Diseases |
|
| Long QT Syndrome |
|
| Digestive System Diseases |
| Pancreatic Diseases |
|
| Fatty Liver |
|
| Cholestasis |
|
| Gastrointestinal Diseases |
|
| Cholera Infantum |
|
| Liver Failure |
|
| Endocrine System Diseases |
| Cushing Syndrome |
|
| Diabetes Mellitus |
|
| Diabetes Insipidus |
|
| Adrenal Cortex Diseases |
|
| PCOS |
|
| Eye Diseases |
| Opsoclonus-Myoclonus Syndrome |
|
| Disorder of eye |
|
| Musculoskeletal Diseases |
| Sacroiliitis |
|
| Osteoporosis |
|
| Pseudogout |
|
| Necrosis |
|
| Synovitis |
|
| Synovial Hypertrophy |
|
| Gout |
|
| Neoplasms |
| Multiple Sclerosis |
|
| Renal Cancer |
|
| ACTH Syndrome |
|
| Rhabdomyoma |
|
| Nervous System Diseases |
| Seizures |
1656808, 2821097, 2169275, 2554740, 7127082, 6324019, 1327015, 6143199, 2853496, 2983143, 11341487, 1965992, 10908253, 6259007, 8928979, 6254450, 19039989, 1324751, 2551692, 6107850, 8381257, 20078871, 8980841, 17287597 |
| Infantile Spasm |
1656808, 17287597, 8381257, 19039989, 8928979, 8980841, 10908253, 20078871, 2983143, 2554740, 1324751, 1965992, 2551692, 6107850, 6259007, 6143199, 1327015, 6254450, 2853496, 11341487 |
| Epilepsy |
1327015, 11341487, 1965992, 8928979, 6254450, 1656808, 1324751, 2554740, 6107850, 8980841, 6259007, 17287597, 19039989, 10908253, 20078871, 6143199, 2983143, 2853496, 8381257, 2551692, 6088243, 4371370, 20708863 |
| Spasmus nutans |
20078871, 8980841, 8381257, 19039989, 6143199, 2983143, 17287597, 8928979, 10908253, 6107850, 2554740, 6259007, 6254450, 1965992, 2853496, 1656808, 2551692, 1327015, 11341487, 1324751 |
| Jacksonian Seizure |
|
| Cerebral Palsy |
|
| Myasthenia Gravis |
|
| Encephalopathies |
|
| Facial paralysis |
|
| Nutritional and Metabolic Diseases |
| Obesity |
|
| Tumoral calcinosis |
|
| Hypernatremia |
|
| Proopiomelanocortin Deficiency |
|
| Nephrocalcinosis |
|
| Gluocose Intolerance |
|
| Psychiatric/Brain disorders |
| Bipolar Disorder |
|
| Restless Legs Syndrome |
|
| Mental Depression |
|
| Manic Disorder |
|
| Amnesia |
|
| Sleep Disorders |
|
| Behavior Disorders |
|
| Mental disorders |
|
| Melancholia |
|
| Autistic Disorder |
|
| Diagnosis, Psychiatric |
|
| Eating Disorders |
|
| Renal Disorder |
| Nephritis |
|
| Glomerulonephritis |
|
| Kidney Tubular Necrosis |
|
| Kidney Calculi |
|
| Oliguria |
|
| Reproductive disorders |
| Peyronie Disease |
|
| Cystitis |
|
| Urinary tract infection |
|
| Preeclampsia |
|
| Respiratory Tract Diseases |
| Pneumonia |
|
|
|
References |
| |
|
| |
| PubMed ID |
Associated gene/s |
Associated condition |
Genetic Mutation |
Diagnostic Criteria |
Association with PCOS |
Ethnicity |
Conclusion |
|
|
|
|
Rotterdam criteria |
Related
|
Total of 337 hirsute patients |
Significantly higher ACTH-stimulated levels of cortisol and 17OHP in hirsute patients indicated adrenal hyperresponsiveness in IH and PCOS |
|
ACVR2A,FEM1B, and SGTA |
|
|
Elevation of circulating androgen levels, either testosterone (T) or nonsex hormone-binding globulin-bound testosterone (uT) associated with chronic oligomenorrhea (6 menses per year) or amenorrhea |
Related
|
There was a total of 502 probands and sisters with PCOS. |
The polymorphic variant, D19S884, in FBN3 is associated with risk of PCOS. POMC is also a candidate gene of interest |
|
5-beta-reductase |
|
|
Rotterdam criteria |
Related
|
90 PCOS women (age 18-45 yr) 45 controls |
Adrenal androgen excess in PCOS is associated with increased inactivation of cortisolthat may lower cortisol blood levels and stimulate ACTH-dependent steroidogenesis |
|
|
Insulin Resistant |
|
|
Related
|
20 nonobese PCOS syndrome and 20 control |
|
|
|
Adrenal androgen excess |
|
NIH criteria |
Related
|
PCOS (n = 9) and without (n = 9) AA excess and controls (n = 12) |
Adrenal androgen excess in PCOS is associated with a greater delta 17-OH activity in response to ACTH. |
|
|
|
|
NICHD criteria |
Related
|
9 reproductive-aged patients with PCOS and 9 controls |
Adrenocortical biosynthesis, basally and in response to ACTH, appears to be closely associated with glucose effectiveness in PCOS. A common factor determining both the effectiveness of glucose to control its own production or uptake and adrenocortical biosynthesis may be aberrant in PCOS. |
|
CYP21 |
|
|
|
Related
|
27 PCOS and 22 control women |
These data suggest that the exaggerated 17-hydroxyprogesterone (17OHP) response to ACTH stimulation in PCOS is revealed by stimulation at a pharmacological dose (250 microg) but not by a physiological dose (1 microg). |
|
Adrenal P450c17alpha |
|
|
|
Related
|
50 women with PCOS (mean age 25.4+/-0.7 years) and 20 healthy women |
Adrenal P450c17alpha enzyme dysregulation in PCOS is revealed by ACTH stimulation at a pharmacological dose (250 microg) but not by a physiological dose (1 microg). LDT is able to demonstrate adrenal hyperactivity characterized by an increase in DHEAS levels. |
|
17-OHP |
|
|
|
Related
|
49 girls(no PP),36 (PP),55(early postmenarcheal) and 30 (late postmenarcheal) |
In conclusion, these findings indicate that girls with PP are at increased risk for anovulation from late (not early) adolescence onward, particularly those girls with a low weight at birth and/or a high 17-OHP response to ACTH at prepubertal diagnosis of PP. |
|
HPA |
|
|
|
Related
|
10 lean and 10 obese women with PCOS compared with 7 lean and 8 obese control |
Hypothalamic-pituitary-adrenal-axis abnormalities of PCOS may be central in origin and abdominal obesity seems to play a key role in the HPA-axis hyperactivity of women with PCOS when naloxone is administered |
|
Cytochrome P450c 17alpha |
|
|
|
Related
|
6 women with PCOS compared with 4 women with normal ovulation. |
In women with PCOS, increases in adrenal androgen sensitivity after physiologic ACTH stimulation reflected in both arms of cytochrome P450c 17alpha activity may be influenced by ovarian activity. However, 17,20-lyase hyperactivity in a subset after pharmacologic ACTH stimulation may be an intrinsic adrenal disorder. |
|
Cortisol |
|
|
|
Related
|
16 normal-weight patients with PCOS and 16 control women |
Cross-correlation analysis showed a more prominent negative correlation in PCOS patients versus controls between plasma cortisol and 40- to 120-minute delayed ACTH concentrations in the morning, indicating a more sustained negative feedback of cortisol on ACTH release in PCOS at this time. Taken together, these findings demonstrate the existence of multifaceted dysregulation of the HPA axis in PCOS. |
|
Cytochrome P450c17alpha |
|
|
The diagnosis of PCOS was made mean 6 SEM. P , 0.05 was regarded as statistically significant. by the presence of polycystic ovaries on pelvic ultrasound examination combined with three or more of the following criteria: oligo/amenorrhoea, hirsutism, hype |
Related
|
68 women with PCOS and 24 normal women |
Although 17-OH progesterone response to ACTH was significantly higher in the patients with PCOS than in the control subjects, the lack of relationship between 17-OH progesterone response to GnRH agonist buserelin and 17-OH progesterone response to ACTH stimulation suggests that the dysregulation of the cytochrome P450c17alpha enzyme may not play a role in adrenal androgen excess seen in PCOS. |
|
|
|
|
|
Related
|
Sixty-three women with ultrasonically detected polycystic ovaries |
Four of 63 (6.4%) women with PCO had responses to ACTH characteristic of non-classical (late onset) 21OHD CAH, and about half the remainder had responses characteristic of 21OHD heterozygotes. There was no clear cut evidence for a deficiency in 3 beta-hydroxysteroid dehydrogenase activity in women with PCO. |
|
|
|
|
|
Related
|
11 women with PCO confirmed by laparoscopy or culdoscopy |
Adrenal dysfunction of PCO most likely represents abnormal control of adrenal androgen production |
|
|
|
|
|
Related
|
ACTH in PCO patients and normal women |
Increased adrenal androgen production in PCO patients is not due to abnormalACTH secretion but arises from either altered adrenal responsiveness to ACTH |
|
LH |
|
|
|
Related
|
15 patients with PCO syndrome were classified into Group A (n = 6) and Group B (n = 9) based on their LH |
The ratios between the sums of concentrations of DHAS to cortisol on days 2 and 4 (P less than 0.001) or 17-OHP to cortisol (P less than 0.05) were elevated in Group B compared with normal subjects. LH, FSH and prolactin values were normal throughout in Group A, but in Group B patients the mean value for LH was significantly elevated before ACTH and at 4 days after ACTH (P less than 0.02). |
|
|
|
|
|
Related
|
8 patients with polycystic ovaries and a similar number of control subjects |
Serum adrenocorticotrophic hormone levels were assayed in 8 patients with polycystic ovaries and a similar number of control subjects. |
|
|
|
|
|
Related
|
33 women with hirsutism and oligomenorrheaand 12 controls |
Eight additional hirsute women were not different than the normals. It appears that a subtle deficiency of 3 beta-hydroxysteroid dehydrogenase may be more common as an explanation of a syndrome resembling polycystic ovarian disease than has been previously recognized. |
|
SRD5A1 and ADIPOQ |
|
|
NIH criteria |
Related
|
Women of European ancestry with PCOS (n = 525) and controls (n = 472), aged 18-45 years. |
Three variants, rs3797179 (SRD5A1), rs12473543 (POMC), and rs1501299 (ADIPOQ), were nominally associated with PCOS. |
|
|
|
|
|
Related
|
12 women aged 17 to 32 years with PCOSand 15 control |
The results are consistent with the hypothesis that women with PCOS may demonstrate hyperfunction of the hypothalamic-pituitary-adrenal axis, which may be involved in the physiopathologic events leading to the complexity of the syndrome. |
|
DEX |
|
|
|
Related
|
6 healthy ovulatory control women compared with 7 womens with PCOS |
The results suggest a certain degree of adrenal participation in the pathogenesis of the hyperandrogenism in these women, which may be the final expression of a synergistic stimulation of the adrenals by hyperinsulinism, relatively high LH, and chronic hyperestrogenism, all of which are present virtually in all women with PCOS. |
|
|
|
|
