PPARD: Polycystic Ovarian Syndrome Database

Gene Information

Gene Symbol

PPARD

Aliases

FAAR, NR1C2, NUC1, NUCI, NUCII, PPARB

Entrez Gene ID

5467

Gene Name

Peroxisome proliferator activated receptor delta

Chromosomal Location

6p21.31

HGNC ID

HGNC:9235

Summary

This gene encodes a member of the peroxisome proliferator-activated receptor (PPAR) family. The encoded protein is thought to function as an integrator of transcriptional repression and nuclear receptor signaling. It may inhibit the ligand-induced transcriptional activity of peroxisome proliferator activated receptors alpha and gamma, though evidence for this effect is inconsistent. Expression of this gene in colorectal cancer cells may be variable but is typically relatively low. Knockout studies in mice suggested a role for this protein in myelination of the corpus callosum, lipid metabolism, differentiation, and epidermal cell proliferation. Alternative splicing results in multiple transcript variants encoding distinct protein isoforms. [provided by RefSeq, Aug 2017]

RefSeq DNA

NG_012345.2

RefSeq mRNA

NM_006238.5, NM_177435.3, NM_001171818.2, NM_001171819.1, NM_001171820.1

e!Ensembl

Gene	ENSG00000112033
Transcript	ENST00000337400, ENST00000311565, ENST00000360694, ENST00000418635, ENST00000448077
Protein	ENSP00000337063, ENSP00000310928, ENSP00000353916, ENSP00000413314, ENSP00000414372

SNPs

SNP Id	Upstream Sequence	SNP	Downstream Sequence	Functional Significance	References
rs2267668	TTGTGGGACTTCAGAAGAGAGAAAGA	C/T	GTGGGCTGGACATCAAAGAAGGCCT	Intron variant	19681917

Gene Ontology (GO)

Show/Hide all(49 )

GO ID	Ontology	Function	Evidence	Reference
GO:0000122	Biological process	Negative regulation of transcription by RNA polymerase II	IBA	21873635
GO:0006006	Biological process	Glucose metabolic process	NAS	15793256
GO:0006091	Biological process	Generation of precursor metabolites and energy	TAS	1333051
GO:0006357	Biological process	Regulation of transcription by RNA polymerase II	TAS	1333051
GO:0006631	Biological process	Fatty acid metabolic process	IBA	21873635
GO:0006635	Biological process	Fatty acid beta-oxidation	TAS	15192438, 15803109
GO:0006915	Biological process	Apoptotic process	IMP	12909723
GO:0007275	Biological process	Multicellular organism development	IBA	21873635
GO:0007566	Biological process	Embryo implantation	TAS	11551955
GO:0008203	Biological process	Cholesterol metabolic process	TAS	15192438
GO:0008283	Biological process	Cell proliferation	TAS	11847022
GO:0009062	Biological process	Fatty acid catabolic process	TAS	15192438
GO:0009755	Biological process	Hormone-mediated signaling pathway	IBA	21873635
GO:0010887	Biological process	Negative regulation of cholesterol storage	IBA	21873635
GO:0019216	Biological process	Regulation of lipid metabolic process	IBA	21873635
GO:0030154	Biological process	Cell differentiation	IBA	21873635
GO:0033993	Biological process	Response to lipid	IBA	21873635
GO:0045600	Biological process	Positive regulation of fat cell differentiation	NAS	10991946
GO:0045892	Biological process	Negative regulation of transcription, DNA-templated	IBA	21873635
GO:0045893	Biological process	Positive regulation of transcription, DNA-templated	IDA	12955147
GO:0045944	Biological process	Positive regulation of transcription by RNA polymerase II	IBA	21873635
GO:0046697	Biological process	Decidualization	TAS	11551955
GO:0050728	Biological process	Negative regulation of inflammatory response	IBA	21873635
GO:0097190	Biological process	Apoptotic signaling pathway	IMP	11551955
GO:1904659	Biological process	Glucose transmembrane transport	NAS	15793256
GO:0005634	Cellular component	Nucleus	IBA	21873635
GO:0005634	Cellular component	Nucleus	NAS	11551955
GO:0090575	Cellular component	RNA polymerase II transcription factor complex	IBA	21873635
GO:0000976	Molecular function	Transcription regulatory region sequence-specific DNA binding	IBA	21873635
GO:0000977	Molecular function	RNA polymerase II regulatory region sequence-specific DNA binding	IBA	21873635
GO:0000981	Molecular function	DNA-binding transcription factor activity, RNA polymerase II-specific	IBA	21873635
GO:0000981	Molecular function	DNA-binding transcription factor activity, RNA polymerase II-specific	ISM	19274049
GO:0000981	Molecular function	DNA-binding transcription factor activity, RNA polymerase II-specific	NAS	19274049
GO:0001103	Molecular function	RNA polymerase II repressing transcription factor binding	IBA	21873635
GO:0001227	Molecular function	DNA-binding transcription repressor activity, RNA polymerase II-specific	IBA	21873635
GO:0003700	Molecular function	DNA-binding transcription factor activity	IDA	12955147
GO:0003700	Molecular function	DNA-binding transcription factor activity	NAS	11551955
GO:0004879	Molecular function	Nuclear receptor activity	IDA	12955147
GO:0005504	Molecular function	Fatty acid binding	IBA	21873635
GO:0005515	Molecular function	Protein binding	IPI	23455924
GO:0008134	Molecular function	Transcription factor binding	IBA	21873635
GO:0008134	Molecular function	Transcription factor binding	IPI	26504087
GO:0008144	Molecular function	Drug binding	IBA	21873635
GO:0008144	Molecular function	Drug binding	IDA	9113987, 10198642
GO:0008289	Molecular function	Lipid binding	IBA	21873635
GO:0008289	Molecular function	Lipid binding	IDA	12955147
GO:0030374	Molecular function	Nuclear receptor transcription coactivator activity	IBA	21873635
GO:0038023	Molecular function	Signaling receptor activity	IBA	21873635
GO:0070539	Molecular function	Linoleic acid binding	IDA	10198642

Protein Information

Protein Name

Peroxisome proliferator-activated receptor delta, PPAR-beta, PPAR-delta, PPARD/MYO1D fusion, nuclear hormone receptor 1, nuclear receptor subfamily 1 group C member 2, peroxisome proliferator-activated receptor beta

Function

Ligand-activated transcription factor. Receptor that binds peroxisome proliferators such as hypolipidemic drugs and fatty acids. Has a preference for poly-unsaturated fatty acids, such as gamma-linoleic acid and eicosapentanoic acid. Once activated by a ligand, the receptor binds to promoter elements of target genes. Regulates the peroxisomal beta-oxidation pathway of fatty acids. Functions as transcription activator for the acyl-CoA oxidase gene. Decreases expression of NPC1L1 once activated by a ligand.

Refseq Proteins

NP_006229.1, NP_803184.1, NP_001165289.1, NP_001165290.1, NP_001165291.1

UniProt

Q03181

PDB

1GWX, 1Y0S, 2AWH, 2B50, 2BAW, 2ENV, 2GWX, 2J14, 2Q5G, 2XYJ, 2XYW, 2XYX, 2ZNP, 2ZNQ, 3D5F, 3DY6, 3ET2, 3GWX, 3GZ9, 3OZ0, 3PEQ, 3SP9, 3TKM, 5U3Q, 5U3R, 5U3S, 5U3T, 5U3U, 5U3V, 5U3W, 5U3X, 5U3Y, 5U3Z, 5U40, 5U41, 5U42, 5U43, 5U44, 5U45, 5U46, 5XMX, 5Y7X, 5ZXI