| |
| |
Gene Symbol |
SHBG |
| |
Aliases |
ABP, SBP, TEBG |
| |
Entrez Gene ID |
|
| |
Gene Name |
Sex hormone binding globulin |
| |
Chromosomal Location |
17p13.1 |
| |
HGNC ID |
|
| |
Summary |
This gene encodes a steroid binding protein that was first described as a plasma protein secreted by the liver but is now thought to participate in the regulation of steroid responses. The encoded protein transports androgens and estrogens in the blood, binding each steroid molecule as a dimer formed from identical or nearly identical monomers. Polymorphisms in this gene have been associated with polycystic ovary syndrome and type 2 diabetes mellitus. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2014]
|
| |
RefSeq DNA |
|
| |
RefSeq mRNA |
|
| |
e!Ensembl
| Gene |
|
|
| Transcript |
ENST00000572182, ENST00000574539, ENST00000576728, ENST00000575314, ENST00000570547, ENST00000572262, ENST00000576478, ENST00000575729, ENST00000380450, ENST00000570527, ENST00000570353, ENST00000416273, ENST00000575903, ENST00000576830, ENST00000571153, ENST00000575618, ENST00000576152, ENST00000441599, ENST00000340624 |
|
| Protein |
ENSP00000458816, ENSP00000458181, ENSP00000459620, ENSP00000458559, ENSP00000458875, ENSP00000459999, ENSP00000461133, ENSP00000458719, ENSP00000369816, ENSP00000461162, ENSP00000458199, ENSP00000388867, ENSP00000458973, ENSP00000460219, ENSP00000458858, ENSP00000459826, ENSP00000461743, ENSP00000393426, ENSP00000345675
|
|
|
|
SNPs
| SNP Id |
Upstream Sequence |
SNP |
Downstream Sequence |
Functional Significance |
References |
| rs727428 |
TTGTGGGACTTCAGAAGAGAGAAAGA |
C/T |
GTGGGCTGGACATCAAAGAAGGCCT |
|
23001781 | |
| rs6259 |
CTTTGCACTACCTCCCTCTAGGAGAA |
A/G |
ACTCTTCCACCTCTTTTTGCCTGAA |
D356N |
23001781 | |
|
| Protein Information |
| |
Protein Name |
Sex hormone-binding globulin, sex steroid-binding protein, testis-specific androgen-binding protein, testosterone-binding beta-globulin, testosterone-estradiol-binding globulin, testosterone-estrogen-binding globulin |
| |
Function |
|
Functions as an androgen transport protein, but may also be involved in receptor mediated processes. Each dimer binds one molecule of steroid. Specific for 5-alpha-dihydrotestosterone, testosterone, and 17-beta-estradiol. Regulates the plasma metabolic clearance rate of steroid hormones by controlling their plasma concentration |
|
| |
|
|
| |
UniProt |
|
| |
PDB |
|
|
|
|
|
Interactions |
| | |
| STRING |
MINT |
IntAct |
| ENSP00000302150 |
|
P01236 |
|
| | |
View interactions
|
| |
| |
Associated Diseases
| Disease group | Disease Name | References |
| Endocrine System Diseases |
| Diabetes Mellitus |
|
| PCOS |
|
| Neoplasms |
| Cancer Metastasis |
|
| Prostate cancer |
|
| Nutritional and Metabolic Diseases |
| Metabolic Syndrome X |
|
|
|
References |
| |
| |
| Liu Qiaorui, Gu Weiqiong, Cui Bin, Hong Jie, Zhang Yifei, Chi Zhenni, Su Yuxia, Ning Guang |
| Shanghai Clinical Center for Endocrine and Metabolic Diseases, Shanghai Institute of Endocrinology and Metabolism, Department of Endocrine and Metabolic Diseases, Shanghai JiaoTong University School of Medicine, Shanghai, People's Republic of China. |
| Endocrine. 2008 Aug-Dec;34(1-3):62-7. doi: 10.1007/s12020-008-9104-8. Epub 2008 |
Abstract
TAAAAn polymorphism in sex hormone-binding globulin (SHBG) gene has been found to influence the transcriptional activity of SHBG gene in vitro, and several studies have reported variable associations of this polymorphism with serum SHBG levels in women with polycystic ovary syndrome (PCOS). We have investigated the association of TAAAAn polymorphism with PCOS in 187 women with PCOS and 176 controls; in which five alleles (6-10 repeats) and 13 genotypes were found. None of the TAAAAn alleles or genotypes occurred in significant different frequency in PCOS patients compared with controls. Serum SHBG in the PCOS group was significantly lower than those in controls (33.8 +/- 30.2 nmol/l vs. 65.58 +/- 31.12 nmol/l; P < 0.01). Serum SHBG concentrations were similar for patients with PCOS whether they displayed short or long genotypes for TAAAAn (Log10SHBG: 1.46 +/- 0.38 and 1.58 +/- 0.33, respectively). Similar results were observed for controls (Log10SHBG: 1.79 +/- 0.17 and 1.77 +/- 0.14, respectively). In contrast, serum SHBG values were negatively associated with body mass index (BMI) and homeostasis model assessment of insulin resistance in the PCOS group (B = -0.285 and -0.264, respectively; P < 0.01). Thus, the TAAAAn polymorphism in SHBG gene was not a determinant of PCOS in this population of Chinese women, whereas, serum SHBG was significantly associated with BMI and insulin resistance in these PCOS patients. |
|
|
|
