| |
| |
Gene Symbol |
SRD5A1 |
| |
Aliases |
S5AR 1 |
| |
Entrez Gene ID |
|
| |
Gene Name |
Steroid 5 alpha-reductase 1 |
| |
Chromosomal Location |
5p15.31 |
| |
HGNC ID |
|
| |
Summary |
Steroid 5-alpha-reductase (EC 1.3.99.5) catalyzes the conversion of testosterone into the more potent androgen, dihydrotestosterone (DHT). Also see SRD5A2 (MIM 607306).[supplied by OMIM, Mar 2008]
|
| |
e!Ensembl
|
|
SNPs
| SNP Id |
Upstream Sequence |
SNP |
Downstream Sequence |
Functional Significance |
References |
| rs3797179 |
AGGACTGCCGCAGGATGCCGAGAAAA |
C/T |
GCGCCCCCCCACCAGGCTGGGCAGC |
L89V |
21530059 | |
|
| Protein Information |
| |
Protein Name |
3-oxo-5-alpha-steroid 4-dehydrogenase 1, SR type 1, steroid 5-alpha-reductase type I, steroid-5-alpha-reductase, alpha polypeptide 1 (3-oxo-5 alpha-steroid delta 4-dehydrogenase alpha 1) |
| |
Function |
|
Converts testosterone into 5-alpha-dihydrotestosterone and progesterone or corticosterone into their corresponding 5-alpha-3-oxosteroids. It plays a central role in sexual differentiation and androgen physiology |
|
| |
UniProt |
|
| |
Pfam |
| Pfam Accession |
Pfam ID |
| PF02544 |
Steroid_dh |
|
|
|
|
|
|
Interactions |
| | |
| STRING |
MINT |
IntAct |
| ENSP00000369816 |
|
P04278 |
|
| | |
View interactions
|
| |
| |
Associated Diseases
| Disease group | Disease Name | References |
| Endocrine System Diseases |
| PCOS |
|
| Neoplasms |
| Prostate cancer |
|
| Ovarian Cancer |
|
| Psychiatric/Brain disorders |
| Manic Disorder |
|
| Mental Depression |
|
| Reproductive disorders |
| Endometrioma |
|
| Endometriosis |
|
|
|
References |
| |
|
| |
| PubMed ID |
Associated gene/s |
Associated condition |
Genetic Mutation |
Diagnostic Criteria |
Association with PCOS |
Ethnicity |
Conclusion |
|
SRD5A2 |
hirsutism |
rs472402, rs2677933, rs248805, rs3822430, rs10060745, rs3797179, rs39848 |
NIH criteria |
Related
|
287 White women with PCOS and 187 controls |
This study presents genetic evidence suggesting an important role of both isoforms of 5alpha-reductase in the pathogenesis of PCOS. That only SRD5A1 haplotypes were associated with hirsutism suggests that only this isoform is important in the hair follicle. |
|
SRD5A2 |
|
SNPs rs39848 and rs3797179 |
|
Related
|
249 women with PCOS and 226 healthy women |
One of the keys in the development of the PCOS is hyperandrogenism, which might be caused by an increased 5-reductase activity, as it is often seen in obesity. This mechanism might therefore be of importance in lean PCOS patients and contribute to the clinical findings. |
|
|
|
|
|
Related
|
11 PCOS women |
There is a marked increase in 5alphaR metabolism of both C19 and C21 steroids in younger women with PCOS. |
|
|
|
|
Women with PCOS were identified based on a history of oligo/amenorrhea, hirsutism, and typical morphological appearance of polycystic ovaries (normal or enlarged ovarian volume with multiple subcapsular cysts <8 mm in diameter) at laparotomy or laparoscop |
Direct
|
18 PCOS and 26 healthy controls |
These data demonstrate elevated 5alpha-reductase activity in polycystic ovaries and support the hypothesis that 5alpha-reduced androgens may play a role in the pathogenesis of PCOS. |
|
POMC and ADIPOQ |
|
|
NIH criteria |
Related
|
PCOS (n = 525) and controls (n = 472), aged 18-45 year |
Variants in candidate genes do not seem to be associated with PCOS risk. |
|
|
|
|
