| |
| |
Gene Symbol |
SRD5A2 |
| |
Aliases |
- |
| |
Entrez Gene ID |
|
| |
Gene Name |
Steroid 5 alpha-reductase 2 |
| |
Chromosomal Location |
2p23.1 |
| |
HGNC ID |
|
| |
Summary |
This gene encodes a microsomal protein expressed at high levels in androgen-sensitive tissues such as the prostate. The encoded protein is active at acidic pH and is sensitive to the 4-azasteroid inhibitor finasteride. Deficiencies in this gene can result in male pseudohermaphroditism, specifically pseudovaginal perineoscrotal hypospadias (PPSH). [provided by RefSeq, Jul 2008]
|
| |
RefSeq DNA |
|
| |
RefSeq mRNA |
|
| |
e!Ensembl
|
|
SNPs
| SNP Id |
Upstream Sequence |
SNP |
Downstream Sequence |
Functional Significance |
References |
| rs523349 |
AAAACGCTACCTGTGGAAGTAATGTA |
C/G |
GCAGAAGAGGCCCAGAAGTACCGTC |
L89V |
21530059 | |
|
| Protein Information |
| |
Protein Name |
3-oxo-5-alpha-steroid 4-dehydrogenase 2, 5 alpha-SR2, S5AR 2, SR type 2, steroid-5-alpha-reductase, alpha polypeptide 2 (3-oxo-5 alpha-steroid delta 4-dehydrogenase alpha 2), type II 5-alpha reductase |
| |
Function |
|
Converts testosterone (T) into 5-alpha-dihydrotestosterone (DHT) and progesterone or corticosterone into their corresponding 5-alpha-3-oxosteroids. It plays a central role in sexual differentiation and androgen physiology. |
|
| |
|
|
| |
UniProt |
|
| |
Pfam |
| Pfam Accession |
Pfam ID |
| PF02544 |
Steroid_dh |
|
|
|
|
|
|
Interactions |
| | |
| STRING |
MINT |
IntAct |
| ENSP00000331327 |
P19544 |
P19544 |
|
| | |
View interactions
|
| |
| |
Associated Diseases
| Disease group | Disease Name | References |
| Endocrine System Diseases |
| Pseudovaginal Perineoscrotal Hypospadias |
7554313, 10718838, 15064320, 9843052, 8768837, 10999800, 15770495, 12843198, 9745434, 10898110, 15528927, 16181229, 16098368, 9208814, 1522235, 8626825, 18314109, 17609295, 25899528, 22876553, 20190539, 19342739, 9467575, 1406794, 9066886, 21631525, 20736251, 14594 |
| 5-Alpha Reductase Deficiency |
|
| PCOS |
|
| Neoplasms |
| Prostate cancer |
|
| Endometrial Cancer |
|
| Psychiatric/Brain disorders |
| Schizophrenia |
|
| Reproductive disorders |
| Penis Hypoplasia |
16181229, 12843198, 15770495, 9745434, 10718838, 9208814, 8626825, 16098368, 8768837, 15064320, 10898110, 7554313, 9843052, 10999800, 15528927, 1522235 |
| Prostatic Hypertrophy |
|
| Prostatic Adenoma |
|
| Endometriosis |
|
| Prostatic Hyperplasia |
|
| Endometrioma |
|
| Skin and Connective Tissue Diseases |
| Alopecia |
|
|
|
References |
| |
|
| |
| PubMed ID |
Associated gene/s |
Associated condition |
Genetic Mutation |
Diagnostic Criteria |
Association with PCOS |
Ethnicity |
Conclusion |
|
SRD5A1 |
|
rs11889731, rs7571644, rs12470143, rs12467911, rs2300697, rs11675297, rs2754530, rs523349 |
NIH criteria |
Related
|
287 White women with PCOS and 187 controls |
This study presents genetic evidence suggesting an important role of both isoforms of 5alpha-reductase in the pathogenesis of PCOS. That only SRD5A1 haplotypes were associated with hirsutism suggests that only this isoform is important in the hair follicle. |
|
|
|
|
