TCF7L2: Polycystic Ovarian Syndrome Database

Gene Information

Gene Symbol

TCF7L2

Aliases

TCF-4, TCF4

Entrez Gene ID

6934

Gene Name

Transcription factor 7 like 2

Chromosomal Location

10q25.2-q25.3

HGNC ID

HGNC:11641

Summary

This gene encodes a high mobility group (HMG) box-containing transcription factor that plays a key role in the Wnt signaling pathway. The protein has been implicated in blood glucose homeostasis. Genetic variants of this gene are associated with increased risk of type 2 diabetes. Several transcript variants encoding multiple different isoforms have been found for this gene.[provided by RefSeq, Oct 2010]

RefSeq DNA

NG_012631.1

RefSeq mRNA

NM_030756.5, NM_001146274.2, NM_001146283.2, NM_001146284.2, NM_001146285.1, NM_001146286.2, NM_001198525.2, NM_001198526.2, NM_001198527.2, NM_001198528.2, NM_001198529.2, NM_001198530.1, NM_001198531.2, NM_001349870.2, NM_001349871.1, NM_001363501.1, NM_001367943.1

e!Ensembl

Gene	ENSG00000148737
Transcript	ENST00000627217, ENST00000369397, ENST00000355717, ENST00000352065, ENST00000369395, ENST00000545257, ENST00000629706, ENST00000346198, ENST00000349937, ENST00000369389, ENST00000637574, ENST00000277945, ENST00000369386, ENST00000466338, ENST00000470254, ENST00000480888, ENST00000534894, ENST00000538897, ENST00000536810, ENST00000355995, ENST00000542695, ENST00000543371
Protein	ENSP00000486891, ENSP00000358404, ENSP00000347949, ENSP00000344823, ENSP00000358402, ENSP00000440547, ENSP00000487507, ENSP00000345640, ENSP00000298692, ENSP00000358396, ENSP00000490478, ENSP00000277945, ENSP00000358393, ENSP00000490260, ENSP00000435694, ENSP00000490004, ENSP00000443626, ENSP00000446172, ENSP00000446238, ENSP00000348274, ENSP00000443883, ENSP00000444972

SNPs

SNP Id	Upstream Sequence	SNP	Downstream Sequence	Functional Significance	References
rs11196236	aaaaaaaaaaaaaaaaaaaGCAGGGG	C/G	CGGGGACAGGGCAGGAGCCCATTCC	Intron variant	19351735, 22301903, 23935130
rs11196229	CGATTACTACGCCTACAGCCCTGTGC	A/G	GGAGCGGGACGCCCACTCCGTCCTC	Intron variant	19351735
rs7903146	TGAGCTTTGATGAGCCTCAGAAGAAC	G/T	CCATGGCCCACAGGAATTCTACGCA	Intron variant	24611738, 23935130, 18958766
rs12255372	CTGCTCTTCAGCTCCCAGAGTCACCA	A/G	TGGTTCCACTTACATACTTGTCCCT	Intron variant	24611738
rs290487	aaaaaaaaaaaaaaaaaaaGCAGGGG	C/G	CGGGGACAGGGCAGGAGCCCATTCC	Intron variant	22296403

Gene Ontology (GO)

Show/Hide all(59 )

GO ID	Ontology	Function	Evidence	Reference
GO:0000122	Biological process	Negative regulation of transcription by RNA polymerase II	IDA	12799378
GO:0001568	Biological process	Blood vessel development	IMP	15578569
GO:0006355	Biological process	Regulation of transcription, DNA-templated	IBA	21873635
GO:0006357	Biological process	Regulation of transcription by RNA polymerase II	IBA	21873635
GO:0006357	Biological process	Regulation of transcription by RNA polymerase II	IDA	9727977
GO:0007050	Biological process	Cell cycle arrest	IMP	12408868
GO:0009749	Biological process	Response to glucose	ISS	19168596
GO:0010909	Biological process	Positive regulation of heparan sulfate proteoglycan biosynthetic process	IMP	15853773
GO:0031016	Biological process	Pancreas development	TAS	18216022
GO:0032024	Biological process	Positive regulation of insulin secretion	IBA	21873635
GO:0032024	Biological process	Positive regulation of insulin secretion	IMP	19386626
GO:0032092	Biological process	Positive regulation of protein binding	IDA	12799378
GO:0032350	Biological process	Regulation of hormone metabolic process	IDA	15525634
GO:0042593	Biological process	Glucose homeostasis	IBA	21873635
GO:0042593	Biological process	Glucose homeostasis	IDA	15525634
GO:0043433	Biological process	Negative regulation of DNA-binding transcription factor activity	IDA	12799378
GO:0043570	Biological process	Maintenance of DNA repeat elements	IMP	18755497
GO:0044334	Biological process	Canonical Wnt signaling pathway involved in positive regulation of epithelial to mesenchymal transition	IMP	17072303
GO:0045444	Biological process	Fat cell differentiation	IDA	10937998
GO:0045892	Biological process	Negative regulation of transcription, DNA-templated	IDA	12799378, 15525634
GO:0045892	Biological process	Negative regulation of transcription, DNA-templated	IMP	16532032
GO:0045944	Biological process	Positive regulation of transcription by RNA polymerase II	IDA	9065401, 19168596
GO:0046827	Biological process	Positive regulation of protein export from nucleus	IMP	19386626
GO:0048625	Biological process	Myoblast fate commitment	IBA	21873635
GO:0048625	Biological process	Myoblast fate commitment	IDA	10937998
GO:0048660	Biological process	Regulation of smooth muscle cell proliferation	IMP	17122440
GO:0050679	Biological process	Positive regulation of epithelial cell proliferation	IMP	12408868
GO:0051897	Biological process	Positive regulation of protein kinase B signaling	IMP	19386626
GO:0060070	Biological process	Canonical Wnt signaling pathway	IBA	21873635
GO:0060070	Biological process	Canonical Wnt signaling pathway	IC	9065401
GO:0090090	Biological process	Negative regulation of canonical Wnt signaling pathway	IMP	16532032
GO:0000790	Cellular component	Nuclear chromatin	IDA	19443654
GO:0005634	Cellular component	Nucleus	IBA	21873635
GO:0005634	Cellular component	Nucleus	IDA	9065401, 16532032, 19386626
GO:0005654	Cellular component	Nucleoplasm	IDA	19168596
GO:0005667	Cellular component	Transcription factor complex	IBA	21873635
GO:0032993	Cellular component	Protein-DNA complex	IDA	14661054
GO:0070369	Cellular component	Beta-catenin-TCF7L2 complex	IDA	9065401, 9065402
GO:0000978	Molecular function	RNA polymerase II proximal promoter sequence-specific DNA binding	IDA	19443654
GO:0000981	Molecular function	DNA-binding transcription factor activity, RNA polymerase II-specific	ISM	19274049
GO:0000981	Molecular function	DNA-binding transcription factor activity, RNA polymerase II-specific	NAS	19274049
GO:0001103	Molecular function	RNA polymerase II repressing transcription factor binding	IPI	19443654
GO:0003682	Molecular function	Chromatin binding	IBA	21873635
GO:0003700	Molecular function	DNA-binding transcription factor activity	IBA	21873635
GO:0003700	Molecular function	DNA-binding transcription factor activity	IDA	9727977
GO:0005515	Molecular function	Protein binding	IPI	11713475, 11713476, 16434966, 16442529, 16569639, 16724116, 17283121, 17873903, 17875931, 18193033, 18772112, 19202075, 19816403, 20126258, 22014570, 22056988, 22304967, 24589551, 28829046, 30833792
GO:0008013	Molecular function	Beta-catenin binding	IBA	21873635
GO:0008013	Molecular function	Beta-catenin binding	IDA	9065401
GO:0008013	Molecular function	Beta-catenin binding	IPI	12408825, 19443654
GO:0008134	Molecular function	Transcription factor binding	IPI	16007074
GO:0019901	Molecular function	Protein kinase binding	IPI	16714285
GO:0035257	Molecular function	Nuclear hormone receptor binding	IPI	12799378
GO:0043565	Molecular function	Sequence-specific DNA binding	IBA	21873635
GO:0043565	Molecular function	Sequence-specific DNA binding	IDA	14661054
GO:0043565	Molecular function	Sequence-specific DNA binding	IMP	16532032
GO:0044212	Molecular function	Transcription regulatory region DNA binding	IBA	21873635
GO:0044212	Molecular function	Transcription regulatory region DNA binding	IDA	20128911
GO:0045295	Molecular function	Gamma-catenin binding	IPI	14661054
GO:0070016	Molecular function	Armadillo repeat domain binding	IPI	12408825

Protein Information

Protein Name

Transcription factor 7-like 2, HMG box transcription factor 4, T-cell factor 4, T-cell-specific transcription factor 4, hTCF-4, transcription factor 7-like 2 (T-cell specific, HMG-box)

Function

Refseq Proteins

NP_110383.2, NP_001139746.1, NP_001139755.1, NP_001139756.1, NP_001139757.1, NP_001139758.1, NP_001185454.1, NP_001185455.1, NP_001185456.1, NP_001185457.1, NP_001185458.1, NP_001185459.1, NP_001185460.1, NP_001336799.1, NP_001336800.1, NP_001350430.1, NP_001354872.1

UniProt

Q9NQB0

PDB

2GL7, 1JDH, 1JPW