TGFB1: Polycystic Ovarian Syndrome Database

Gene Information

Gene Symbol

TGFB1

Aliases

CED, DPD1, IBDIMDE, LAP, TGF-beta1, TGFB, TGFbeta

Entrez Gene ID

7040

Gene Name

Transforming growth factor beta 1

Chromosomal Location

19q13.2

HGNC ID

HGNC:11766

Summary

This gene encodes a secreted ligand of the TGF-beta (transforming growth factor-beta) superfamily of proteins. Ligands of this family bind various TGF-beta receptors leading to recruitment and activation of SMAD family transcription factors that regulate gene expression. The encoded preproprotein is proteolytically processed to generate a latency-associated peptide (LAP) and a mature peptide, and is found in either a latent form composed of a mature peptide homodimer, a LAP homodimer, and a latent TGF-beta binding protein, or in an active form consisting solely of the mature peptide homodimer. The mature peptide may also form heterodimers with other TGFB family members. This encoded protein regulates cell proliferation, differentiation and growth, and can modulate expression and activation of other growth factors including interferon gamma and tumor necrosis factor alpha. This gene is frequently upregulated in tumor cells, and mutations in this gene result in Camurati-Engelmann disease. [provided by RefSeq, Aug 2016]

RefSeq DNA

NG_013364.1

RefSeq mRNA

NM_000660.7

e!Ensembl

Gene	ENSG00000105329
Transcript	ENST00000598758, ENST00000221930
Protein	ENSP00000472767, ENSP00000221930

SNPs

SNP Id	Upstream Sequence	SNP	Downstream Sequence	Functional Significance	References
rs4803457	TTGTGGGACTTCAGAAGAGAGAAAGA	C/T	GTGGGCTGGACATCAAAGAAGGCCT	Intron variant,upstream variant 2KB	25594618

Gene Ontology (GO)

Show/Hide all(143 )

GO ID	Ontology	Function	Evidence	Reference
GO:0000165	Biological process	MAPK cascade	IMP	21147091
GO:0001837	Biological process	Epithelial to mesenchymal transition	IDA	25893292, 29529050
GO:0001933	Biological process	Negative regulation of protein phosphorylation	IDA	8053900
GO:0001934	Biological process	Positive regulation of protein phosphorylation	IDA	18625725
GO:0002062	Biological process	Chondrocyte differentiation	IDA	15040835
GO:0002244	Biological process	Hematopoietic progenitor cell differentiation	IDA	15451575
GO:0002248	Biological process	Connective tissue replacement involved in inflammatory response wound healing	TAS	9639571
GO:0003180	Biological process	Aortic valve morphogenesis	IMP	26634652
GO:0006611	Biological process	Protein export from nucleus	IDA	9770491, 17438144, 18588859
GO:0006754	Biological process	ATP biosynthetic process	IDA	10513816
GO:0006796	Biological process	Phosphate-containing compound metabolic process	IDA	10513816
GO:0006954	Biological process	Inflammatory response	IDA	21147091
GO:0007050	Biological process	Cell cycle arrest	IDA	14555988
GO:0007093	Biological process	Mitotic cell cycle checkpoint	IDA	15334054
GO:0007173	Biological process	Epidermal growth factor receptor signaling pathway	IDA	18625725
GO:0007179	Biological process	Transforming growth factor beta receptor signaling pathway	IBA	21873635
GO:0007179	Biological process	Transforming growth factor beta receptor signaling pathway	IDA	9389648, 11157754
GO:0007182	Biological process	Common-partner SMAD protein phosphorylation	IDA	20573232
GO:0007183	Biological process	SMAD protein complex assembly	IDA	17438144
GO:0007435	Biological process	Salivary gland morphogenesis	IEP	18080134
GO:0008284	Biological process	Positive regulation of cell proliferation	IDA	10513816, 14633705
GO:0008284	Biological process	Positive regulation of cell proliferation	IMP	26169693
GO:0008285	Biological process	Negative regulation of cell proliferation	IDA	15334054
GO:0008285	Biological process	Negative regulation of cell proliferation	IMP	11158066
GO:0009611	Biological process	Response to wounding	IEP	18040277
GO:0010575	Biological process	Positive regulation of vascular endothelial growth factor production	TAS	19506300
GO:0010628	Biological process	Positive regulation of gene expression	IDA	18625725, 18832382, 18941241, 19913496, 25322725, 26634652, 26687115, 27162619, 29167509
GO:0010628	Biological process	Positive regulation of gene expression	IGI	22269326
GO:0010628	Biological process	Positive regulation of gene expression	IMP	26169693
GO:0010629	Biological process	Negative regulation of gene expression	IDA	19913496, 20067797, 22269326, 25163461, 26634652, 29167509, 29529050
GO:0010629	Biological process	Negative regulation of gene expression	IGI	22269326
GO:0010716	Biological process	Negative regulation of extracellular matrix disassembly	IC	22269326
GO:0010718	Biological process	Positive regulation of epithelial to mesenchymal transition	IDA	17999987, 18505915
GO:0010718	Biological process	Positive regulation of epithelial to mesenchymal transition	NAS	21319131
GO:0010742	Biological process	Macrophage derived foam cell differentiation	IC	15219857
GO:0010763	Biological process	Positive regulation of fibroblast migration	IDA	18555217
GO:0010800	Biological process	Positive regulation of peptidyl-threonine phosphorylation	IDA	18625725, 19736306
GO:0010862	Biological process	Positive regulation of pathway-restricted SMAD protein phosphorylation	IBA	21873635
GO:0010862	Biological process	Positive regulation of pathway-restricted SMAD protein phosphorylation	IDA	9389648, 19736306, 26634652
GO:0010936	Biological process	Negative regulation of macrophage cytokine production	IDA	20875417
GO:0016477	Biological process	Cell migration	IDA	25893292
GO:0017015	Biological process	Regulation of transforming growth factor beta receptor signaling pathway	IDA	15334054
GO:0019049	Biological process	Evasion or tolerance of host defenses by virus	IDA	15334054
GO:0022408	Biological process	Negative regulation of cell-cell adhesion	IDA	18593713
GO:0030214	Biological process	Hyaluronan catabolic process	IDA	17324121
GO:0030308	Biological process	Negative regulation of cell growth	IDA	15334054
GO:0030334	Biological process	Regulation of cell migration	TAS	19018011
GO:0030335	Biological process	Positive regulation of cell migration	IDA	19736306
GO:0030335	Biological process	Positive regulation of cell migration	IMP	26169693
GO:0030501	Biological process	Positive regulation of bone mineralization	IEP	17401695
GO:0031293	Biological process	Membrane protein intracellular domain proteolysis	IDA	25310401
GO:0031334	Biological process	Positive regulation of protein complex assembly	IDA	19366691
GO:0031663	Biological process	Lipopolysaccharide-mediated signaling pathway	IDA	21147091
GO:0032270	Biological process	Positive regulation of cellular protein metabolic process	IDA	15219857
GO:0032355	Biological process	Response to estradiol	IDA	18039789
GO:0032570	Biological process	Response to progesterone	IDA	18039789
GO:0032740	Biological process	Positive regulation of interleukin-17 production	IDA	18453574
GO:0032801	Biological process	Receptor catabolic process	IDA	17878231
GO:0032930	Biological process	Positive regulation of superoxide anion generation	IDA	22073128
GO:0032967	Biological process	Positive regulation of collagen biosynthetic process	IDA	19734317, 22269326, 25310401
GO:0032967	Biological process	Positive regulation of collagen biosynthetic process	IGI	22269326
GO:0032967	Biological process	Positive regulation of collagen biosynthetic process	IMP	11158066
GO:0033138	Biological process	Positive regulation of peptidyl-serine phosphorylation	IDA	18625725, 19736306
GO:0035307	Biological process	Positive regulation of protein dephosphorylation	IDA	14555988
GO:0042127	Biological process	Regulation of cell proliferation	IBA	21873635
GO:0042307	Biological process	Positive regulation of protein import into nucleus	IDA	19366691
GO:0042981	Biological process	Regulation of apoptotic process	IBA	21873635
GO:0043117	Biological process	Positive regulation of vascular permeability	IDA	21168935
GO:0043406	Biological process	Positive regulation of MAP kinase activity	IDA	18625725
GO:0043408	Biological process	Regulation of MAPK cascade	IBA	21873635
GO:0043491	Biological process	Protein kinase B signaling	IMP	21147091
GO:0043536	Biological process	Positive regulation of blood vessel endothelial cell migration	IDA	18555217
GO:0043537	Biological process	Negative regulation of blood vessel endothelial cell migration	IDA	18555217
GO:0043552	Biological process	Positive regulation of phosphatidylinositol 3-kinase activity	IDA	18625725
GO:0043932	Biological process	Ossification involved in bone remodeling	IEP	17401695
GO:0045216	Biological process	Cell-cell junction organization	IDA	18505915
GO:0045596	Biological process	Negative regulation of cell differentiation	IEP	19357233
GO:0045599	Biological process	Negative regulation of fat cell differentiation	IDA	15040835
GO:0045662	Biological process	Negative regulation of myoblast differentiation	IDA	9770491
GO:0045786	Biological process	Negative regulation of cell cycle	IDA	11502704
GO:0045892	Biological process	Negative regulation of transcription, DNA-templated	IDA	15702480, 18832382
GO:0045893	Biological process	Positive regulation of transcription, DNA-templated	IDA	9389648, 14517293, 15334054, 16816361
GO:0045918	Biological process	Negative regulation of cytolysis	IDA	24586048
GO:0045930	Biological process	Negative regulation of mitotic cell cycle	IDA	14555988
GO:0045944	Biological process	Positive regulation of transcription by RNA polymerase II	IDA	18832382
GO:0048298	Biological process	Positive regulation of isotype switching to IgA isotypes	IDA	14988498
GO:0048468	Biological process	Cell development	IBA	21873635
GO:0048642	Biological process	Negative regulation of skeletal muscle tissue development	IDA	9770491
GO:0050680	Biological process	Negative regulation of epithelial cell proliferation	IDA	9950587
GO:0050680	Biological process	Negative regulation of epithelial cell proliferation	IMP	16943770
GO:0050714	Biological process	Positive regulation of protein secretion	IDA	18505915
GO:0050731	Biological process	Positive regulation of peptidyl-tyrosine phosphorylation	IDA	21168935
GO:0050921	Biological process	Positive regulation of chemotaxis	IDA	18555217
GO:0051897	Biological process	Positive regulation of protein kinase B signaling	IDA	18625725
GO:0060312	Biological process	Regulation of blood vessel remodeling	IC	22269326
GO:0060312	Biological process	Regulation of blood vessel remodeling	NAS	22269326
GO:0060389	Biological process	Pathway-restricted SMAD protein phosphorylation	IDA	11157754, 17999987, 18453574, 25893292
GO:0060390	Biological process	Regulation of SMAD protein signal transduction	IDA	25893292
GO:0060391	Biological process	Positive regulation of SMAD protein signal transduction	IDA	9389648, 19366691, 29167509
GO:0060395	Biological process	SMAD protein signal transduction	IBA	21873635
GO:0060965	Biological process	Negative regulation of gene silencing by miRNA	IGI	22269326
GO:0070168	Biological process	Negative regulation of biomineral tissue development	IDA	26634652
GO:0070374	Biological process	Positive regulation of ERK1 and ERK2 cascade	IDA	25310401
GO:0070723	Biological process	Response to cholesterol	IDA	17878231
GO:0071407	Biological process	Cellular response to organic cyclic compound	IDA	21147091
GO:0071560	Biological process	Cellular response to transforming growth factor beta stimulus	IDA	19736306, 22269326
GO:0071560	Biological process	Cellular response to transforming growth factor beta stimulus	IGI	22269326
GO:0085029	Biological process	Extracellular matrix assembly	IDA	19734317
GO:0097191	Biological process	Extrinsic apoptotic signaling pathway	IDA	15334054
GO:1900126	Biological process	Negative regulation of hyaluronan biosynthetic process	IDA	17324121
GO:1900182	Biological process	Positive regulation of protein localization to nucleus	IDA	26634652
GO:1901203	Biological process	Positive regulation of extracellular matrix assembly	IC	22269326
GO:1901666	Biological process	Positive regulation of NAD+ ADP-ribosyltransferase activity	IDA	22073128
GO:1902893	Biological process	Regulation of pri-miRNA transcription by RNA polymerase II	IMP	18548003
GO:1902895	Biological process	Positive regulation of pri-miRNA transcription by RNA polymerase II	IDA	26311719, 26493107
GO:1903077	Biological process	Negative regulation of protein localization to plasma membrane	IDA	21168935, 24586048
GO:1903799	Biological process	Negative regulation of production of miRNAs involved in gene silencing by miRNA	IGI	22269326
GO:1903800	Biological process	Positive regulation of production of miRNAs involved in gene silencing by miRNA	IDA	18548003
GO:2000679	Biological process	Positive regulation of transcription regulatory region DNA binding	IDA	22073128
GO:2000727	Biological process	Positive regulation of cardiac muscle cell differentiation	IDA	25163461
GO:0005615	Cellular component	Extracellular space	IBA	21873635
GO:0005615	Cellular component	Extracellular space	IDA	19734317
GO:0005634	Cellular component	Nucleus	IDA	18040277
GO:0005737	Cellular component	Cytoplasm	IDA	18040277
GO:0005902	Cellular component	Microvillus	IDA	19366691
GO:0009986	Cellular component	Cell surface	IMP	19366691
GO:0062023	Cellular component	Collagen-containing extracellular matrix	HDA	23979707
GO:0072562	Cellular component	Blood microparticle	HDA	22516433
GO:0003823	Molecular function	Antigen binding	IPI	16754747
GO:0005114	Molecular function	Type II transforming growth factor beta receptor binding	IBA	21873635
GO:0005114	Molecular function	Type II transforming growth factor beta receptor binding	IDA	11157754
GO:0005114	Molecular function	Type II transforming growth factor beta receptor binding	IMP	8167376
GO:0005114	Molecular function	Type II transforming growth factor beta receptor binding	IPI	1333888
GO:0005125	Molecular function	Cytokine activity	IBA	21873635
GO:0005125	Molecular function	Cytokine activity	TAS	24263861
GO:0005160	Molecular function	Transforming growth factor beta receptor binding	IBA	21873635
GO:0005515	Molecular function	Protein binding	IPI	1326540, 2022183, 2119582, 7852346, 8370410, 8617200, 10092230, 10746731, 10885742, 10930463, 11157754, 15247411, 15864306, 17827158, 18672106, 19651619, 20505824, 20856203, 20860622, 21054789, 21441952, 21677751, 25241761, 25416956, 25548275, 29909984
GO:0019899	Molecular function	Enzyme binding	IPI	19366691
GO:0034713	Molecular function	Type I transforming growth factor beta receptor binding	IMP	8167376
GO:0034713	Molecular function	Type I transforming growth factor beta receptor binding	IPI	10885742
GO:0034714	Molecular function	Type III transforming growth factor beta receptor binding	IMP	8167376
GO:0034714	Molecular function	Type III transforming growth factor beta receptor binding	IPI	10092230
GO:0042802	Molecular function	Identical protein binding	IPI	21677751

Protein Information

Protein Name

Transforming growth factor beta-1 proprotein, TGF-beta-1, latency-associated peptide, prepro-transforming growth factor beta-1, transforming growth factor beta1

Function

Refseq Proteins

NP_000651.3

UniProt

P01137

Pfam

Pfam Accession	Pfam ID
PF00019	TGF_beta
PF00688	TGFb_propeptide