VDR: Polycystic Ovarian Syndrome Database

Gene Information

Gene Symbol

VDR

Aliases

NR1I1, PPP1R163

Entrez Gene ID

7421

Gene Name

Vitamin D receptor

Chromosomal Location

12q13.11

HGNC ID

HGNC:12679

Summary

This gene encodes vitamin D3 receptor, which is a member of the nuclear hormone receptor superfamily of ligand-inducible transcription factors. This receptor also functions as a receptor for the secondary bile acid, lithocholic acid. Downstream targets of vitamin D3 receptor are principally involved in mineral metabolism, though this receptor regulates a variety of other metabolic pathways, such as those involved in immune response and cancer. Mutations in this gene are associated with type II vitamin D-resistant rickets. A single nucleotide polymorphism in the initiation codon results in an alternate translation start site three codons downstream. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. A recent study provided evidence for translational readthrough in this gene, and expression of an additional C-terminally extended isoform via the use of an alternative in-frame translation termination codon. [provided by RefSeq, Jun 2018]

RefSeq DNA

NG_008731.1

RefSeq mRNA

NM_001017535.1, NM_000376.3, NM_001017535.2, NM_001017536.2, NM_001364085.2, NM_001374661.1, NM_001374662.1

e!Ensembl

Gene	ENSG00000111424
Transcript	ENST00000549336, ENST00000395324, ENST00000229022, ENST00000550325, ENST00000547065, ENST00000546653, ENST00000550314, ENST00000548664
Protein	ENSP00000449573, ENSP00000378734, ENSP00000229022, ENSP00000447173, ENSP00000449074, ENSP00000448659, ENSP00000449561, ENSP00000450105

SNPs

SNP Id	Upstream Sequence	SNP	Downstream Sequence	Functional Significance	References
rs731236	CCTGGGGTGCAGGACGCCGCGCTGAT	C/T	GAGGCCATCCAGGACCGCCTGTCCA	Synonymous codon,upstream variant 2KB	24078159, 21082232
rs10735810	CCTGGGGTGCAGGACGCCGCGCTGAT	C/T	GAGGCCATCCAGGACCGCCTGTCCA	M1T	21082232
rs1544410	CCTGGGGTGCAGGACGCCGCGCTGAT	C/T	GAGGCCATCCAGGACCGCCTGTCCA	Intron variant,upstream variant 2KB	21082232
rs7975232	GAAGGCACAGGAGCTCTCAGCTGGGC	A/C	CCTCACTGCTCAATCCCACCACCCC	Intron variant,upstream variant 2KB	21082232, 28127831
rs757343	TTTGGAGGCAATGTGCAGTGACCCTT	A/G	ACCTCTTCCGCTGGTTAGAGGTGAG	Intron variant,upstream variant 2KB	21082232, 23246977

Gene Ontology (GO)

Show/Hide all(47 )

GO ID	Ontology	Function	Evidence	Reference
GO:0000122	Biological process	Negative regulation of transcription by RNA polymerase II	IDA	17426122
GO:0000902	Biological process	Cell morphogenesis	IMP	17223341
GO:0007165	Biological process	Signal transduction	TAS	2849209
GO:0007275	Biological process	Multicellular organism development	IBA	21873635
GO:0008285	Biological process	Negative regulation of cell proliferation	IDA	16549446
GO:0009887	Biological process	Animal organ morphogenesis	IBA	21873635
GO:0010628	Biological process	Positive regulation of gene expression	IMP	17223341
GO:0010839	Biological process	Negative regulation of keratinocyte proliferation	IMP	17223341
GO:0010980	Biological process	Positive regulation of vitamin D 24-hydroxylase activity	IDA	16549446
GO:0030154	Biological process	Cell differentiation	IBA	21873635
GO:0038183	Biological process	Bile acid signaling pathway	IDA	12016314
GO:0045618	Biological process	Positive regulation of keratinocyte differentiation	IMP	17082781
GO:0045892	Biological process	Negative regulation of transcription, DNA-templated	IDA	11891224
GO:0045944	Biological process	Positive regulation of transcription by RNA polymerase II	IBA	21873635
GO:0045944	Biological process	Positive regulation of transcription by RNA polymerase II	IMP	17082781, 17254542
GO:0046697	Biological process	Decidualization	IEP	16720713
GO:0070561	Biological process	Vitamin D receptor signaling pathway	IDA	16549446
GO:0070561	Biological process	Vitamin D receptor signaling pathway	IMP	28698609
GO:0005634	Cellular component	Nucleus	IBA	21873635
GO:0005634	Cellular component	Nucleus	IDA	15589699, 17082781
GO:0043235	Cellular component	Receptor complex	IDA	17426122
GO:0090575	Cellular component	RNA polymerase II transcription factor complex	IBA	21873635
GO:0090575	Cellular component	RNA polymerase II transcription factor complex	IDA	17426122
GO:0000976	Molecular function	Transcription regulatory region sequence-specific DNA binding	IBA	21873635
GO:0000977	Molecular function	RNA polymerase II regulatory region sequence-specific DNA binding	IBA	21873635
GO:0000981	Molecular function	DNA-binding transcription factor activity, RNA polymerase II-specific	IBA	21873635
GO:0000981	Molecular function	DNA-binding transcription factor activity, RNA polymerase II-specific	ISM	19274049
GO:0000981	Molecular function	DNA-binding transcription factor activity, RNA polymerase II-specific	NAS	19274049
GO:0003677	Molecular function	DNA binding	IDA	11891224
GO:0003700	Molecular function	DNA-binding transcription factor activity	IDA	17426122
GO:0004879	Molecular function	Nuclear receptor activity	IDA	12016314, 16549446, 17082781
GO:0004879	Molecular function	Nuclear receptor activity	IMP	28698609
GO:0005499	Molecular function	Vitamin D binding	IBA	21873635
GO:0005515	Molecular function	Protein binding	IPI	9632709, 9653119, 10409738, 10744685, 10866662, 12840015, 17254542, 17426122, 20089040, 20227041, 20413580, 21119599, 21478865, 21988832, 22179700, 25910212, 27728806
GO:0008134	Molecular function	Transcription factor binding	IBA	21873635
GO:0030374	Molecular function	Nuclear receptor transcription coactivator activity	IBA	21873635
GO:0038023	Molecular function	Signaling receptor activity	IBA	21873635
GO:0038023	Molecular function	Signaling receptor activity	IDA	16549446
GO:0038186	Molecular function	Lithocholic acid receptor activity	IDA	12016314
GO:0046965	Molecular function	Retinoid X receptor binding	IDA	28698609
GO:0046965	Molecular function	Retinoid X receptor binding	IPI	17426122
GO:0070644	Molecular function	Vitamin D response element binding	IBA	21873635
GO:0070644	Molecular function	Vitamin D response element binding	IDA	17426122
GO:1902098	Molecular function	Calcitriol binding	IBA	21873635
GO:1902098	Molecular function	Calcitriol binding	IDA	10678179, 12016314
GO:1902098	Molecular function	Calcitriol binding	IMP	28698609
GO:1902121	Molecular function	Lithocholic acid binding	IDA	12016314

Protein Information

Protein Name

Vitamin D3 receptor, 1,25-dihydroxyvitamin D3 receptor, nuclear receptor subfamily 1 group I member 1, protein phosphatase 1, regulatory subunit 163, vitamin D (1,25- dihydroxyvitamin D3) receptor, vitamin D nuclear receptor variant 1

Function

Nuclear receptor for calcitriol, the active form of vitamin D3 which mediates the action of this vitamin on cells (PubMed:28698609, PubMed:16913708, PubMed:15728261, PubMed:10678179). Enters the nucleus upon vitamin D3 binding where it forms heterodimers with the retinoid X receptor/RXR (PubMed:28698609). The VDR-RXR heterodimers bind to specific response elements on DNA and activate the transcription of vitamin D3-responsive target genes. Plays a central role in calcium homeostasis

Refseq Proteins

NP_001017535.1, NP_000367.1, NP_001017536.1, NP_001351014.1, NP_001361590.1, NP_001361591.1

UniProt

P11473

PDB

1YNW, 1DB1, 1IE8, 1IE9, 1KB2, 1KB4, 1KB6, 1S0Z, 1S19, 1TXI, 2HAM, 2HAR, 2HAS, 2HB7, 2HB8, 3A2I, 3A2J, 3A3Z, 3A40, 3A78, 3AUQ, 3AUR, 3AX8, 3AZ1, 3AZ2, 3AZ3, 3B0T, 3CS4, 3CS6, 3KPZ, 3M7R, 3OGT, 3P8X, 3TKC, 3VHW, 3W0A, 3W0C, 3W0Y, 3WGP, 3WWR, 3X31, 3X36, 4G2I, 4ITE, 4ITF, 5GT4, 5V39, 5YSY, 5YT2

Pfam

Pfam Accession	Pfam ID
PF00104	Hormone_recep
PF00105	zf-C4