YAP1: Polycystic Ovarian Syndrome Database

Gene Information

Gene Symbol

YAP1

Aliases

COB1, YAP, YAP2, YAP65, YKI

Entrez Gene ID

10413

Gene Name

Yes1 associated transcriptional regulator

Chromosomal Location

11q22.1

HGNC ID

HGNC:16262

Summary

This gene encodes a downstream nuclear effector of the Hippo signaling pathway which is involved in development, growth, repair, and homeostasis. This gene is known to play a role in the development and progression of multiple cancers as a transcriptional regulator of this signaling pathway and may function as a potential target for cancer treatment. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Aug 2013]

RefSeq DNA

NG_029530.2

RefSeq mRNA

NM_001130145.3, NM_006106.5, NM_001195044.2, NM_001195045.2, NM_001282097.2, NM_001282098.2, NM_001282099.1, NM_001282100.1, NM_001282101.1

e!Ensembl

Gene	ENSG00000137693
Transcript	ENST00000526343, ENST00000282441, ENST00000629586, ENST00000531439, ENST00000524575, ENST00000529029, ENST00000537274, ENST00000345877, ENST00000615667
Protein	ENSP00000434134, ENSP00000282441, ENSP00000487519, ENSP00000431574, ENSP00000435602, ENSP00000431626, ENSP00000445635, ENSP00000331023, ENSP00000478927

SNPs

SNP Id	Upstream Sequence	SNP	Downstream Sequence	Functional Significance	References
rs1894116	TTGTGGGACTTCAGAAGAGAGAAAGA	C/T	GTGGGCTGGACATCAAAGAAGGCCT	Intron variant	22885925

Gene Ontology (GO)

Show/Hide all(32 )

GO ID	Ontology	Function	Evidence	Reference
GO:0006974	Biological process	Cellular response to DNA damage stimulus	IDA	18280240
GO:0008283	Biological process	Cell proliferation	IDA	17974916
GO:0032570	Biological process	Response to progesterone	IDA	16772533
GO:0033148	Biological process	Positive regulation of intracellular estrogen receptor signaling pathway	IDA	16772533
GO:0035329	Biological process	Hippo signaling	IBA	21873635
GO:0035329	Biological process	Hippo signaling	TAS	18158288
GO:0045893	Biological process	Positive regulation of transcription, DNA-templated	IDA	20368466
GO:0045893	Biological process	Positive regulation of transcription, DNA-templated	IMP	20123905
GO:0045944	Biological process	Positive regulation of transcription by RNA polymerase II	IBA	21873635
GO:0045944	Biological process	Positive regulation of transcription by RNA polymerase II	IDA	25796446
GO:0050767	Biological process	Regulation of neurogenesis	IDA	25433207
GO:0050847	Biological process	Progesterone receptor signaling pathway	IDA	16772533
GO:0060242	Biological process	Contact inhibition	IDA	17974916
GO:0065003	Biological process	Protein-containing complex assembly	IDA	20368466
GO:0065003	Biological process	Protein-containing complex assembly	IMP	20123905
GO:0071480	Biological process	Cellular response to gamma radiation	IDA	18280240
GO:0072091	Biological process	Regulation of stem cell proliferation	IDA	25433207
GO:0005634	Cellular component	Nucleus	IBA	21873635
GO:0005634	Cellular component	Nucleus	IDA	17974916, 18158288, 18280240, 25796446, 28169360
GO:0005737	Cellular component	Cytoplasm	IBA	21873635
GO:0005737	Cellular component	Cytoplasm	IDA	17974916, 18158288
GO:0071148	Cellular component	TEAD-1-YAP complex	IDA	20123905
GO:0071149	Cellular component	TEAD-2-YAP complex	IDA	20368466
GO:0003713	Molecular function	Transcription coactivator activity	IBA	21873635
GO:0003713	Molecular function	Transcription coactivator activity	IDA	18158288, 18280240, 20368466, 25796446
GO:0003713	Molecular function	Transcription coactivator activity	IMP	20123905
GO:0003714	Molecular function	Transcription corepressor activity	IBA	21873635
GO:0003714	Molecular function	Transcription corepressor activity	IDA	18158288
GO:0005515	Molecular function	Protein binding	IPI	7644498, 9202023, 9305852, 11278422, 11278685, 15161933, 17502622, 17974916, 18158288, 18280240, 18579750, 19439659, 19914168, 20048001, 20368466, 21187284, 21376238, 22234184, 22525271, 22863277, 22921829, 22948661, 23245941, 24211253, 24255178, 24366813, 24525233, 24581491, 248825
GO:0033613	Molecular function	Activating transcription factor binding	IPI	20123905, 20368466
GO:0044212	Molecular function	Transcription regulatory region DNA binding	IDA	18280240
GO:0046982	Molecular function	Protein heterodimerization activity	IPI	20123905, 20368466

Protein Information

Protein Name

Transcriptional coactivator YAP1, 65 kDa Yes-associated protein, Yes associated protein 1, protein yorkie homolog, yes-associated protein 1, yes-associated protein 2, yes-associated protein YAP65 homolog, yorkie homolog

Function

Transcriptional regulator which can act both as a coactivator and a corepressor and is the critical downstream regulatory target in the Hippo signaling pathway that plays a pivotal role in organ size control and tumor suppression by restricting proliferation and promoting apoptosis (PubMed:17974916, PubMed:18280240, PubMed:18579750, PubMed:21364637, PubMed:30447097). The core of this pathway is composed of a kinase cascade wherein STK3/MST2 and STK4/MST1, in complex with its regulatory protein SAV1, phosphorylates and activates LATS1/2 in complex with its regulatory protein MOB1, which in turn phosphorylates and inactivates YAP1 oncoprotein and WWTR1/TAZ (PubMed:18158288). Plays a key role in tissue tension and 3D tissue shape by regulating cortical actomyosin network formation. Acts via ARHGAP18, a Rho GTPase activating protein that suppresses F-actin polymerization (PubMed:25778702). Plays a key role to control cell proliferation in response to cell contact. Phosphorylation of YAP1 by LATS1/2 inhibits its translocation into the nucleus to regulate cellular genes important for cell proliferation, cell death, and cell migration (PubMed:18158288). The presence of TEAD transcription factors are required for it to stimulate gene expression, cell growth, anchorage-independent growth, and epithelial mesenchymal transition (EMT) induction (PubMed:18579750). .; [Isoform 2]: Isoform 2 and isoform 3 can activate the C-terminal fragment (CTF) of ERBB4 (isoform 3).

Refseq Proteins

NP_001123617.1, NP_006097.2, NP_001181973.1, NP_001181974.1, NP_001269026.1, NP_001269027.1, NP_001269028.1, NP_001269029.1, NP_001269030.1

UniProt

P46937

PDB

3MHR, 6G6X, 6G8P, 6G8Q, 2LAW, 2LAX, 2LAY, 2LTV, 2LTW, 3KYS, 4RE1, 6HIL, 5OAQ, 6GE3, 6GE4, 6GE5, 6GE6, 6GEC, 6GEE, 6GEG, 6GEI, 6GEK, 6HIK, 1JMQ, 1K5R, 1K9Q, 1K9R, 4REX, 5YDX, 5YDY